Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of WBP5-WW domain binding protein 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WBP5-WW domain binding protein 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023544 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WBP5 |
| Origin species: | Human |
| Product name: | WBP5-WW domain binding protein 5 Gene |
| Size: | 2ug |
| Accessions: | BC023544 |
| Gene id: | 51186 |
| Gene description: | WW domain binding protein 5 |
| Synonyms: | WBP5; WEX6; transcription elongation factor A protein-like 9; TCEA-like protein 9; WBP-5; WW domain binding protein 1; WW domain-binding protein 5; pp21 homolog; transcription elongation factor S-II protein-like 9; transcription elongation factor A like 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaatcctgtcaaaaaatggaaggaaaaccagaaaatgagagtgaaccaaagcatgaggaagagccaaagcctgaggaaaagccagaagaggaggagaagctagaggaggaggccaaagcaaaaggaacttttagagaaaggctgattcaatctctccaggagtttaaagaagatatacacaacaggcatttaagcaatgaagatatgtttagagaagtggatgaaatagatgagataaggagagtcagaaacaaacttatagtgatgcgttggaaggttaatcgaaaccatccttacccctatttaatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - L antigen family, member 3 - RNA binding motif protein 4 - RNA binding motif protein 9 - acid phosphatase 1, soluble |