RBM9-RNA binding motif protein 9 Gene View larger

RBM9-RNA binding motif protein 9 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBM9-RNA binding motif protein 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBM9-RNA binding motif protein 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025281
Product type: DNA & cDNA
Ncbi symbol: RBM9
Origin species: Human
Product name: RBM9-RNA binding motif protein 9 Gene
Size: 2ug
Accessions: BC025281
Gene id: 23543
Gene description: RNA binding motif protein 9
Synonyms: RBM9; FOX2; Fox-2; HNRBP2; HRNBP2; RTA; dJ106I20.3; fxh; RNA binding protein fox-1 homolog 2; RNA-binding motif protein 9; fox-1 homolog B; fox-1 homologue; hexaribonucleotide-binding protein 2; repressor of tamoxifen transcriptional activity; RNA binding protein, fox-1 homolog 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaaaagaaaatggtaactcagggtaaccaggagccgacaacaactcctgacgcaatggttcagccttttactaccatcccatttccaccacctccgcagaatggaattcccacagagtatggggtgccacacactcaagactatgccggccagaccggtgagcataacctgacactctacggaagtacgcaagcccacggggagcagagcagcaactcacccagcacacaaaatggatctcttacgacagaaggtggagcacagacagacggccagcagtcacagacacaaagtagtgaaaattcagagagtaaatctaccccgaaacggctgcatgtctctaatattcctttccgcttccgggaccctgacctccggcagatgtttgggcagtttggcaaaatcctagatgtagaaataatctttaatgaacgtggctctaagggattcgggttcgtaactttcgagaatagtgctgatgcagacagggccagggagaaattacacggcaccgtggtagagggccgtaaaatcgaggtgaataatgctacagcacgtgtaatgaccaataagaagatggtcacaccatatgcaaatggttggaaattaagcccagtagttggagctgtatatggtccggagttatatgcagcatccagctttcaagcagatgtgtccctaggcaatgatgcagcagtgcccctatcaggaagagggggtatcaacacttacattcctttaatcagtctccctttagttcctggcttcccttaccctactgcagccaccacggcagccgctttcagaggagcccatttgaggggcagagggcggacagtatatggtgcagtccgagcggtacctccaacagccatccccgcctatccaggtgtggtttaccaggacggattttacggtgctgacctctatggtggatatgcagcctacagatatgcacagcctgctactgcaaccgcagccaccgctgctgcagccgctgcagccgcttacagtgacggttatggcagggtgtacacagccgacccctaccatgcccttgcccctgccgctagctatggagttggcgctgtggcgagtttataccgaggtggctacagccgatttgccccctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acid phosphatase 1, soluble
- phospholipid scramblase 1
- lipoma HMGIC fusion partner
- methylmalonyl CoA epimerase

Buy RBM9-RNA binding motif protein 9 Gene now

Add to cart