Cart 8 Product Products 1 063,53 € (empty)
-
1 x SPACA1-spe...121,50 € -
1 x MTHFD2L-me...113,40 € -
1 x MGC72080-M...113,40 € -
-
1 x RNF220-rin...113,40 € -
1 x BRUNOL5-br...121,50 € -
1 x DNA pol ε...259,07 € -
No products
To be determined Shipping
1 063,53 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 063,53 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 063,53 €
Data sheet of MRFAP1-Mof4 family associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRFAP1-Mof4 family associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022797 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRFAP1 |
| Origin species: | Human |
| Product name: | MRFAP1-Mof4 family associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC022797 |
| Gene id: | 93621 |
| Gene description: | Mof4 family associated protein 1 |
| Synonyms: | PGR1; MORF4 family-associated protein 1; Mof4 family associated protein 1; T-cell activation protein; protein associated with MRG of 14 kDa; Morf4 family associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggcccctggacatcgtcgagctggcggaaccggaggaagtggaggtgctggagcccgaggaggatttcgagcagtttctgctcccggtcatcaacgagatgcgcgaggacatcgcgtcgctgacgcgcgagcacgggcgggcgtacctgcggaaccggagcaagctgtgggagatggacaatatgctcatccagatcaaaacgcaggtggaggcctcggaggagagcgccctcaaccacctccagaacccgggcgacgcggccgagggccgggcggccaagaggtgcgagaaggccgaggagaaggccaaggagattgcgaagatggcagagatgctggtggagctggtccggcggatagagaagagcgagtcgtcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal-regulatory protein beta 1 - regulator of G-protein signaling 5 - RAB20, member RAS oncogene family - 4-hydroxyphenylpyruvate dioxygenase |