Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PRRG2-proline rich Gla (G-carboxyglutamic acid) 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRRG2-proline rich Gla (G-carboxyglutamic acid) 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026032 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRRG2 |
| Origin species: | Human |
| Product name: | PRRG2-proline rich Gla (G-carboxyglutamic acid) 2 Gene |
| Size: | 2ug |
| Accessions: | BC026032 |
| Gene id: | 5639 |
| Gene description: | proline rich Gla (G-carboxyglutamic acid) 2 |
| Synonyms: | PRGP2; transmembrane gamma-carboxyglutamic acid protein 2; proline rich Gla (G-carboxyglutamic acid) 2; proline-rich Gla (G-carboxglutamic acid) polypeptide 2; proline-rich Gla (G-carboxyglutamic acid) polypeptide 2; proline-rich Gla protein 2; proline-rich gamma-carboxyglutamic acid protein 2; proline rich and Gla domain 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctttgggtccagaagtctttctgggtcccccagaggcccagagcttcctgagtagccatacccggattccaagagccaaccactgggacctggagctgctcacaccagggaacctggaacgggagtgtctggaagagaggtgttcctgggaagaggccagggagtattttgaggacaacactctcacggagcgcttttgggagagctacatctacaatggcaaaggagggcgtggacgagtggatgtggccagcctggctgtggggctgacatgtggcatcctgctcattgtcctggccggcctgggagccttttggtatctgcgctggcgacagcaccgaggccagcagccctgtccccaagaggccgggctcattagccctctgagtcctttgaaccctctgggcccaccgacgcccctgcctccacccccacccccacccccaggcctccccacctatgagcaggcgctggcagcctctggggtacacgacgcacctccacccccctacaccagcctcaggaggcctcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - putative homeodomain transcription factor 2 - spastic paraplegia 11 (autosomal recessive) - serine hydroxymethyltransferase 1 (soluble) - anterior gradient homolog 3 (Xenopus laevis) |