PHTF2-putative homeodomain transcription factor 2 Gene View larger

PHTF2-putative homeodomain transcription factor 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHTF2-putative homeodomain transcription factor 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PHTF2-putative homeodomain transcription factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022419
Product type: DNA & cDNA
Ncbi symbol: PHTF2
Origin species: Human
Product name: PHTF2-putative homeodomain transcription factor 2 Gene
Size: 2ug
Accessions: BC022419
Gene id: 57157
Gene description: putative homeodomain transcription factor 2
Synonyms: putative homeodomain transcription factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccaaagtcacagatgctatagtctggtatcaaaagaagattggagcatatgatcaacaaatatgggaaaaatctgttgaacagagagaaatcaagtttattaaactggggctaaggaataaaccaaagaaaacagcacatgtgaaaccagacctcatagatgttgatcttgtaagagggtctgcatttgcaaaggcaaagcctgaaagtccttggacttctctgaccagaaagggaattgttcgagttgtatttttcccctttttcttccggtggtggttacaagtaacatcaaaggtcatctttttctggcttcttgtcctttatcttcttcaagttgctgcaatagtattattctgctccacttctagcccacacagcatacctctgacagaggtgattgggccgatatggctgatgctgctcctgggaactgtgcattgccagattgtttccacaagaacacccaaacctcctctaagtacagggggtaaaagaagaaggaaattaagaaaagcagcccatttggaagtacatagggaaggagatggttctagtaccacagataacacacaagagggagcagttcagaaccacggtacaagcacctctcacagcgttggcactgtcttcagagatctctggcatgctgctttctttttatcaggatcaaagaaagcaaagaattcaattgataaatcaactgaaactgacaatggctatgtatcccttgatgggaagaagactgttaaaagcggtgaagatggaatacaaaaccatgaacctcagtgtgaaactattcgaccagaagagacagcctggaacacaggaacactgaggaatggtcctagcaaagatacccaaaggacaataacaaatgtctctgatgaagtctccagtgaggaaggtcctgaaacaggatactcattacgtcgtcatgtggacaggacttctgaaggtgttcttcggaatagaaagtcacaccattataagaaacattaccctaatgaggtatatactttgtccttaagtgtatacatacatatctattttatatgttactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spastic paraplegia 11 (autosomal recessive)
- serine hydroxymethyltransferase 1 (soluble)
- anterior gradient homolog 3 (Xenopus laevis)
- sushi-repeat-containing protein, X-linked 2

Buy PHTF2-putative homeodomain transcription factor 2 Gene now

Add to cart