Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ROBLD3-roadblock domain containing 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ROBLD3-roadblock domain containing 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024190 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ROBLD3 |
| Origin species: | Human |
| Product name: | ROBLD3-roadblock domain containing 3 Gene |
| Size: | 2ug |
| Accessions: | BC024190 |
| Gene id: | 28956 |
| Gene description: | roadblock domain containing 3 |
| Synonyms: | ROBLD3; ENDAP; HSPC003; MAPBPIP; MAPKSP1AP; Ragulator2; p14; ragulator complex protein LAMTOR2; MAPBP-interacting protein; MAPKSP1 adaptor protein; endosomal adaptor protein p14; late endosomal/lysosomal Mp1-interacting protein; late endosomal/lysosomal adaptor and MAPK and MTOR activator 2; mitogen-activated protein-binding protein-interacting protein (MAPBPIP); roadblock domain containing 3; roadblock domain-containing protein 3; late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcgccccaaggctttgacccaggtgctaagccaagccaacactggaggcgtccagagcaccctgctgctgaataacgagggatcactgctggcctactctggttacggggacactgacgcccgggtcaccgctgccatagccagtaacatctgggccgcctacgaccggaacgggaaccaagcgtttaatgaagacaatctcaaattcatcctcatggactgcatggagggccgtgtagccatcacccgagtggccaaccttctgctgtgtatgtatgccaaggagaccgtgggctttggaatgctcaaggccaaggcccaggctttggtgcagtacctggaggagcccctcacccaagtggcggcatcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - jagunal homolog 1 (Drosophila) - TGFB-induced factor homeobox 2 - upstream transcription factor 1 - ATP-grasp domain containing 1 |