Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DSN1-DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene
PTXBC058899
New product
Data sheet of DSN1-DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DSN1-DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058899 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DSN1 |
| Origin species: | Human |
| Product name: | DSN1-DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC058899 |
| Gene id: | 79980 |
| Gene description: | DSN1, MIND kinetochore complex component, homolog (S. cerevisiae) |
| Synonyms: | DSN1 homolog, MIS12 kinetochore complex component; DSN1, MIS12 kinetochore complex component; DSN1, MIND kinetochore complex component, homolog; kinetochore-associated protein DSN1 homolog; C20orf172; KNL3; MIS13; dJ469A13.2; hKNL-3; kinetochore null 3 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacttcagtgactagatcagagatcatagatgaaaaaggaccagtgatgtctaagactcatgatcatcaattggaatcaagtctcagtcctgtggaagtgtttgctaaaacatctgcctccctggagatgaatcaaggcgtttcagaggaaagaattcaccttggctctagccctaaaaaagggggaaattgtgatctcagccaccaggaaagacttcagtcgaagtcccttcatttgtctcctcaagaacaatctgccagttatcaagacaggaggcaatcctggcggcgagcaagtatgaaagaaacgaaccggcggaagtcgctgcatcccattcaccagggcatcacagagctcagccggtctatcagtgtcgatttagcagaaagcaaacggcttggctgtctcctgctttccagtttccagttctctattcagaaacttgaacctttcctaagggacactaagggcttcagtcttgaaagttttagagccaaagcatcttctctttctgaagaattgaaacattttgcagacggactggaaactgatggaactctacaaaaatgttttgaagattcaaatggaaaagcatcagatttttctttggaagcatctgtggctgagatgaaggaatacataacaaagttttctttagaacgtcagacttgggatcagctcttgcttcactaccagcaggaggctaaagagatattgtccagaggatcaactgaggccaaaattactgaggtcaaagtggaacctatgacatatcttgggtcttctcagaatgaagttcttaatacaaaacctgactaccagaaaatattacagaaccagagcaaagtctttgactgtatggagttggtgatggatgaactgcaaggatcagtgaaacagctgcaggcctttatggatgaaagtacccagtgcttccagaaggtgtcagtacagctcggaaagagaagcatgcaacaattagatccctcaccagctcgaaaactgttgaagcttcagctacagaacccacctgccatacatggatctggatctggatcttgtcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22 (organic anion transporter), member 7 - solute carrier family 22 (organic anion transporter), member 9 - N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) - solute carrier family 22 (organic anion transporter), member 7 |