Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NAT8B-N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) Gene
PTXBC069564
New product
Data sheet of NAT8B-N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NAT8B-N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069564 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NAT8B |
| Origin species: | Human |
| Product name: | NAT8B-N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) Gene |
| Size: | 2ug |
| Accessions: | BC069564 |
| Gene id: | 51471 |
| Gene description: | N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) |
| Synonyms: | CML2; Hcml2; NAT8BP; ATase1; N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene); N-acetyltransferase Camello 2; acetyltransferase 1; camello-like protein 2; N-acetyltransferase 8B (putative, gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgaacacgccccagccaccttccggcgattactgaagctgcctcgaaccctcatactcttacttgggggggcccttgccctactcctggtctctggctcctggattctggccctcgtgttcagcctcagcctccttcctgccctgtggttccttgccaaaaaaccctggacgcggtatgtagacatagcattgcgcacagacatgtctgacatcaccaaatcctacctgagtgagtgtggctcctgcttctgggtgggtgaatctgaagagaaggtggtgggcacagtaggagctctgcccgttgatgatcccaccttgagggagaagcggttgcagctgtttcatctctctgtggacaatgagcaccgtggtcaggggatagcaaaagccctggtcaggactgtcctccagtttgcccgggactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22 (organic anion transporter), member 7 - RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 - leucine rich repeat and fibronectin type III domain containing 3 |