Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of NALCN-sodium leak channel, non-selective Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NALCN-sodium leak channel, non-selective Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064343 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NALCN |
| Origin species: | Human |
| Product name: | NALCN-sodium leak channel, non-selective Gene |
| Size: | 2ug |
| Accessions: | BC064343 |
| Gene id: | 259232 |
| Gene description: | sodium leak channel, non-selective |
| Synonyms: | CLIFAHDD; CanIon; IHPRF; IHPRF1; INNFD; VGCNL1; bA430M15.1; sodium leak channel non-selective protein; four repeat voltage-gated ion channel; voltage gated channel like 1; voltage gated channel-like protein 1; sodium leak channel, non-selective |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcaaaaggaagcagagttccagggtggaagcccagccagtcactgactttggtcctgatgagtctctgtcggataatgctgacatcctctggattaacaaaccatgggttcactctttgctgcgcatctgtgccatcatcagcgtcatttctgtttgtatgaatacgccaatgaccttcgagcactatcctccacttcagtatgtgaccttcactttggatacattattgatgtttctctacacggcagagatgatagcaaaaatgcacatccggggcattgtcaagggggatagttcctatgtgaaagatcgctggtgtgtttttgatggatttatggtcttttgcctttgggtttctttggtgctacaggtgtttgaaattgctgatatagttgatcagatgtcaccttggggcatgttgcggattccacggccactgattatgatccgagcattccggatttatttccgatttgaactgccaaggaccagaattacaaatattttaaagcgatcgggagaacaaatatggagtgtttccatttttctacttttctttctacttctttatggaattttaggagttcagatgtttggaacatttacttatcactgtgttgtaaatgacacaaagccaggactctcactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coenzyme Q9 homolog (S. cerevisiae) - neuroepithelial cell transforming 1 - cytokine-like nuclear factor n-pac - ELK1, member of ETS oncogene family |