Cart 12 Product Products 3 647,07 € (empty)
-
-
-
-
-
-
1 x WISP2-WNT1...113,40 € -
-
-
-
-
-
No products
To be determined Shipping
3 647,07 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 647,07 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 647,07 €
Data sheet of N-PAC-cytokine-like nuclear factor n-pac Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about N-PAC-cytokine-like nuclear factor n-pac Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064940 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | N-PAC |
| Origin species: | Human |
| Product name: | N-PAC-cytokine-like nuclear factor n-pac Gene |
| Size: | 2ug |
| Accessions: | BC064940 |
| Gene id: | 84656 |
| Gene description: | cytokine-like nuclear factor n-pac |
| Synonyms: | cytokine-like nuclear factor n-pac; N-PAC; BM045; HIBDL; 3-hydroxyisobutyrate dehydrogenase-like protein; nuclear protein 60 kDa; nuclear protein 60kDa; nuclear protein NP60; nuclear protein of 60 kDa; glyoxylate reductase 1 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgataaaaattaacaagggtaaacgattccagcaagcggtagatgctgtcgaagagttcctcaggagagccaaagggaaagaccagacgtcatcccacaattcttctgatgacaagaatcgacgtaattccagtgaggagagaagtaggccaaactcaggtgatgagaagcgcaaacttagcctgtctgaagggaaggtgaagaagaacatgggagaaggaaagaagagggtgtcttcaggctcttcagagagaggctccaaatcccctctgaaaagagcccaagagcaaagtccccggaagcggggtcggcccccaaaggatgagaaggatctcaccatcccggagtctagtaccgtgaaggggatgatggccggaccgatggccgcgtttaaatggcagccaaccgcaagcgagcctgttaaagatgcagatcctcatttccatcatttcctgctaagccaaacagagaagccagctgtctgttaccaggcaatcacgaagaagttgaaaatatgtgaagaggaaactggctccacctccatccaggcagctgacagcacagccgtgaatggcagcatcacacccacagacaaaaagataggatttttgggccttggtctcatgggaagtggaatcgtctccaacttgctaaaaatgggtcacacagtgactgtctggaaccgcactgcagagaaatgtgatttgttcatccaggagggggcccgtctgggaagaacccccgctgaagtcgtctcaacctgcgacatcactttcgcctgcgtgtcggatcccaaggcggccaaggacctggtgctgggccccagtggtgtgctgcaagggatccgccctgggaagtgctacgtggacatgtcaacagtggacgctgacaccgtcactgagctggcccaggtgattgtgtccaggggggggcgctttctggaagcccccgtctcagggaatcagcagctgtctaatgacgggatgttggtgatcttagcggctggagacaggggcttatatgaggactgcagcagctgcttccaggcgatggggaagacctccttcttcctaggtgaagtgggcaatgcagccaagatgatgctgatcgtgaacatggtccaagggagcttcatggccactattgccgaggggctgaccctggcccaggtgacaggccagtcccagcagacactcttggacatcctcaatcagggacagttggccagcatcttcctggaccagaagtgccaaaatatcctgcaaggaaactttaagcctgatttctacctgaaatacattcagaaggatctccgcttagccattgcgctgggtgatgcggtcaaccatccgactcccatggcagctgcagcaaatgaggtgtacaaaagagccaaggcgctggaccagtccgacaacgatatgtccgccgtgtaccgagcctacatacactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ELK1, member of ETS oncogene family - peptidase M20 domain containing 1 - troponin I type 2 (skeletal, fast) - leucine rich repeat containing 29 |