Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HBXIP-hepatitis B virus x interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HBXIP-hepatitis B virus x interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062619 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HBXIP |
| Origin species: | Human |
| Product name: | HBXIP-hepatitis B virus x interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC062619 |
| Gene id: | 10542 |
| Gene description: | hepatitis B virus x interacting protein |
| Synonyms: | HBXIP; XIP; ragulator complex protein LAMTOR5; HBV X-interacting protein; HBx-interacting protein; hepatitis B virus x interacting protein; hepatitis B virus x-interacting protein (9.6kD); late endosomal/lysosomal adaptor and MAPK and MTOR activator 5; late endosomal/lysosomal adaptor, MAPK and MTOR activator 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagccaggtgcaggtcacctcgacggtcaccgcgcggggagcccaagccttcgtcaggctctgtgcgacggaagcgcagtgatgttttccagtaaagaacgcggacgttgcaccgtgatcaattttgtccctttggaggcgccgttacggtccacgccccgctcgcgtcaagtgactgaggcctgtggtggagaaggacgtgccgtgccgctgggttctgagccggagtggtcggtgggtgggatggaggcgaccttggagcagcacttggaagacacaatgaagaatccctccattgttggagtcctgtgcacagattcacaaggacttaatctgggttgccgcgggaccctgtcagatgagcatgctggagtgatatctgttctagcccagcaagcagctaagctaacctctgaccccactgatattcctgtggtgtgtctagaatcagataatgggaacattatgatccagaaacacgatggcatcacggtggcagtgcacaaaatggcctcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat and SOCS box-containing 7 - methionine adenosyltransferase II, beta - Fanconi anemia, complementation group A - X-ray radiation resistance associated 1 |