Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MAT2B-methionine adenosyltransferase II, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAT2B-methionine adenosyltransferase II, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066645 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAT2B |
| Origin species: | Human |
| Product name: | MAT2B-methionine adenosyltransferase II, beta Gene |
| Size: | 2ug |
| Accessions: | BC066645 |
| Gene id: | 27430 |
| Gene description: | methionine adenosyltransferase II, beta |
| Synonyms: | MAT-II; MATIIbeta; Nbla02999; SDR23E1; TGR; methionine adenosyltransferase 2 subunit beta; MAT II beta; beta regulatory subunit of methionine adenosyltransferase; dTDP-4-keto-6-deoxy-D-glucose 4-reductase; methionine adenosyltransferase II, beta; short chain dehydrogenase/reductase family 23E, member 1; testicular tissue protein Li 118; methionine adenosyltransferase 2B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggggcgggagaaagagctctctatacactttgttcccgggagctgtcggctggtggaggaggaagttaacatccctaataggagggttctggttactggtgccactgggcttcttggcagagctgtacacaaagaatttcagcagaataattggcatgcagttggctgtggtttcagaagagcaagaccaaaatttgaacaggttaatctgttggattctaatgcagttcatcacatcattcatgattttcagccccatgttatagtacattgtgcagcagagagaagaccagatgttgtagaaaatcagccagatgctgcctctcaacttaatgtggatgcttctgggaatttagcaaaggaagcagctgctgttggagcatttctcatctacattagctcagattatgtatttgatggaacaaatccaccttacagagaggaagacataccagctcccctaaatttgtatggcaaaacaaaattagatggagaaaaggctgtcctggagaacaatctaggagctgctgttttgaggattcctattctgtatggggaagttgaaaagctcgaagaaagtgctgtgactgttatgtttgataaagtgcagttcagcaacaagtcagcaaacatggatcactggcagcagaggttccccacacatgtcaaagatgtggccactgtgtgccggcagctagcagagaagagaatgctggatccatcaattaagggaacctttcactggtctggcaatgaacagatgactaagtatgaaatggcatgtgcaattgcagatgccttcaacctccccagcagtcacttaagacctattactgacagccctgtcctaggagcacaacgtccgagaaatgctcagcttgactgctccaaattggagatcttgggcattggccaacgaacaccatttcgaattggaatcaaagaatcactttggcctttcctcattgacaagagatggagacaaacggtctttcattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Fanconi anemia, complementation group A - X-ray radiation resistance associated 1 - hypothetical protein LOC100127888 - ankyrin repeat and SOCS box-containing 6 |