Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ELL-elongation factor RNA polymerase II Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELL-elongation factor RNA polymerase II Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064558 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELL |
| Origin species: | Human |
| Product name: | ELL-elongation factor RNA polymerase II Gene |
| Size: | 2ug |
| Accessions: | BC064558 |
| Gene id: | 8178 |
| Gene description: | elongation factor RNA polymerase II |
| Synonyms: | ELL gene (11-19 lysine-rich leukemia gene); RNA polymerase II elongation factor ELL; C19orf17; ELL1; MEN; PPP1R68; eleven-nineteen lysine-rich leukemia protein; elongation factor RNA polymerase II; protein phosphatase 1, regulatory subunit 68; elongation factor for RNA polymerase II |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacttggaaaggtggtggggggtggatggcggctgtgactcagggcccagggatcacatgggggtcactgctgccatcagcagtcaggcagggagaacagaaatgcaaaaatacagatgtctatttttctaaactggggggtggaggggtgcctcctgacagcttccaaagagctgactgtggagggcccacagtgtatcccacccctgcccgagagtctctctcctttgggacccccgggttcccagagctccgaggaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 25 - glutathione S-transferase omega 2 - glutathione S-transferase alpha 1 - proline/serine-rich coiled-coil 1 |