Cart 4 Product Products 749,50 € (empty)
-
1 x TMEM184A-t...121,50 € -
-
1 x CEBPE-CCAA...121,50 € -
1 x TLX2-T-cel...121,50 €
No products
To be determined Shipping
749,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 749,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 749,50 €
Data sheet of PSRC1-proline/serine-rich coiled-coil 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSRC1-proline/serine-rich coiled-coil 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056909 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSRC1 |
| Origin species: | Human |
| Product name: | PSRC1-proline/serine-rich coiled-coil 1 Gene |
| Size: | 2ug |
| Accessions: | BC056909 |
| Gene id: | 84722 |
| Gene description: | proline/serine-rich coiled-coil 1 |
| Synonyms: | FP3214; proline/serine-rich coiled-coil protein 1; differential display and activated by p53; p53-regulated DDA3; proline/serine-rich coiled-coil 1; proline and serine rich coiled-coil 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggatttggaggaagatgtaaggtttattgtggatgagaccttggactttggggggctgtcaccatctgacagccgtgaggaggaagacataacagtgttggtgactccagagaaaccacttcgacggggcctctcccaccgaagtgacccaaatgcagtggcacctgccccccagggtgtgaggctcagcctaggccccctcagtccagagaagctggaggagatcctcgatgaggccaaccggctggccgctcagctggagcagtgtgccctgcaggatcgggagagcgcaggcgagggcctggggcctcgccgagtgaagcccagtcctcggcgggagacctttgtgctgaaggatagtcctgtccgagacctgctgcccactgtgaactctttgacgcggagcaccccctccccaagcagcctgacgcctcgactccggagtaatgataggaaggggtcagtcagggctctccgggctacatctggaaagaggccctccaacatgaagagggagtcacccacttgcaatctgttccctgcatccaaaagcccagcatcttctcctcttacccgatcgactcccccagtccgggggagagccgggcccagtgggagagcagcagccagtgaggagaccagagcagccaagttgcgggtgagtgggagtggggagtttgtgggattgaccctgaaatttctccacccctctccaccaggcccacccacccccatcagatccgtcctggccccacagccttctaccagcaactctcaacgcctgccccggccgcagggagcagctgctaaatcttccagtcaactgcccattccctcggccatccccaggcctgccagccgaatgccactcaccagccggagtgtgccacctggcagaggtgccctacctccggattctctgtcaactcgaaaagggcttccaagaccaagcactgcaggacacagagtgcgggaaagtggacacaaggttcctgtttcccagcgactaaatcttcctgtcatgggtgccactcgcagcaatctgcagccccccaggaaagtggcagtcccaggacctaccaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 50 - glutathione S-transferase kappa 1 - voltage-dependent anion channel 3 - TBC1 domain family, member 10C |