Login to display prices
Login to display prices
NUP35-nucleoporin 35kDa Gene View larger

NUP35-nucleoporin 35kDa Gene

PTXBC047029

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUP35-nucleoporin 35kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUP35-nucleoporin 35kDa Gene

Proteogenix catalog: PTXBC047029
Ncbi symbol: NUP35
Product name: NUP35-nucleoporin 35kDa Gene
Size: 2ug
Accessions: BC047029
Gene id: 129401
Gene description: nucleoporin 35kDa
Synonyms: MP-44; MP44; NP44; NUP53; nucleoporin NUP53; mitotic phosphoprotein 44; nuclear pore complex protein Nup53; nucleoporin 35kDa; nucleoporin 35
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcctttgcagtggaacctcaggggcccgcgttaggatctgaaccaatgatgctgggttcacccacatctccaaagccaggagttaatgcccagttcttacctggatttttaatgggggatttgccagctccggtgactccacaacctcgatcaattagtggcccttcagtaggagtaatggaaatgagatcacctttacttgcaggtgggtcaccaccacaaccagttgtaccagctcataaagataaaagtggcgctccaccagttagaagtatatatgatgacatttctagcccaggacttggatcaacacctttaacttcaagaagacagccaaacatttcagtaatgcagagtcctcttgttggagttacatctactcctggaacagggcaaagtatgtttagtccagcaagtatcggtcagccacgaaagacgacattatctcctgcccagttggatcctttttatactcaaggagattctttgacttcagaagatcacctcgatgactcttgggtgactgtatttgggtttcctcaagcatctgcttcctacatattactacaatttgcacagtatgggaatatcttaaaacatgtgatgtctaatacaggaaattggatgcatattcgttatcaatctaaactgcaggctcggaaagccttaagcaaagatgggaggatttttggagaatccatcatgattggtgtaaaaccatgtattgacaaaagtgttatggaaagcagtgacagatgtgctttatcatctccatctttagcctttacaccaccaatcaaaactctaggtacaccaacacaacctggaagtactcctaggatttctaccatgagacctcttgctacagcatacaaagcctctactagtgattatcaggttatttctgacagacaaacgccaaaaaaagatgaaagtcttgtatccaaagcaatggagtacatgtttggctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: