Cart 19 Product Products 2 503,97 € (empty)
-
1 x MBD5-methy...113,40 € -
1 x POLR2I-pol...113,40 € -
1 x PDAP1-PDGF...113,40 € -
1 x ICT1-immat...113,40 € -
1 x STK25-seri...121,50 € -
-
-
1 x LMO3-LIM...113,40 € -
-
1 x GPR162-G...121,50 € -
1 x PPP1R2-pro...113,40 € -
1 x UBPH...259,07 € -
-
-
1 x ELAC1-elaC...121,50 € -
1 x LOC339047-...113,40 € -
1 x DNASE1-deo...121,50 € -
-
No products
To be determined Shipping
2 503,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 503,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 503,97 €
Data sheet of NUP62-nucleoporin 62kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUP62-nucleoporin 62kDa Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC050717 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUP62 |
| Origin species: | Human |
| Product name: | NUP62-nucleoporin 62kDa Gene |
| Size: | 2ug |
| Accessions: | BC050717 |
| Gene id: | 23636 |
| Gene description: | nucleoporin 62kDa |
| Synonyms: | nucleoporin Nup62; IBSN; SNDI; p62; nuclear pore glycoprotein p62; 62 kDa nucleoporin; nucleoporin 62kD; nucleoporin 62kDa; nucleoporin 62 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcctgttctcacttgccacccagactccggccacacagacgacaggcttcacttttggaacagcgactcttgcttcggggggaactggattttctttggggatcggtgcttcaaagctcaacttgagcaacacagctgccaccccagccatggcaaaccccagcggctttgggctgggcagcagcaacctcactaatgccatatcgagcaccgtcacctccagccagggcacagcacccaccggctttgtgtttggcccctccaccacctctgtggctccagctaccacatctggaggcttctcattcactggtggaagcacggcccaaccctccggtttcaacattggctcagcagggaattcagcccagcccacggcacctgccacgttgcccttcactccggccacgccagcagccaccacagcaggtgccacacagccagctgctcccacacccacagccaccatcaccagcactgggcccagcctctttgcgtcaatagcaactgctccaacctcatctgccaccactggactctccctctgtacccctgtgaccacagcgggcgcccccactgctgggacacagggcttcagcttaaaggcacctggagcagcttccggcacctccacaacaacatccaccgctgccaccgccaccgccaccaccaccagcagcagcagcaccaccggctttgccttgaatttaaaaccactggcgccagccgggatccccagcaatacagcagctgccgtgaccgctccacctggccctggcgcagctgcaggggcggctgccagctccgccatgacctacgcgcagctggagagcctgatcaacaaatggagcctggagctagaggaccaggagcggcacttcctccagcaggccacccaggtcaacgcctgggaccgcacgctgatcgagaatggagaaaagatcaccagcctgcaccgcgaggtggagaaggtgaagctggaccagaagaggctggaccaggagctcgacttcatcctgtcccagcagaaggagctggaagacctgctgagcccactggaggagttggtcaaggagcagagcgggaccatctacctgcagcacgcggatgaggagcgtgagaaaacctacaagctggctgagaacatcgacgcacagctcaagcgcatggcccaggatctcaaggacatcatcgagcacctgaacacgtccggggcccccgccgacaccagtgacccactgcagcagatctgcaagatcctcaatgcgcacatggactcactgcagtggatcgaccagaactcggccctgctgcagaggaaggtggaggaggtgaccaaggtgtgcgagggccggcgcaaggagcaggagcgcagcttccggatcacctttgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - attractin-like 1 - F-box protein 38 - ferredoxin 1-like - neurocalcin delta |