Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene
PTXBC043564
New product
Data sheet of KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC043564 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNA2 |
| Origin species: | Human |
| Product name: | KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC043564 |
| Gene id: | 3737 |
| Gene description: | potassium voltage-gated channel, shaker-related subfamily, member 2 |
| Synonyms: | EIEE32; HBK5; HK4; HUKIV; MK2; NGK1; RBK2; potassium voltage-gated channel subfamily A member 2; potassium channel, voltage gated shaker related subfamily A, member 2; potassium voltage-gated channel, shaker-related subfamily, member 2; voltage-gated K(+) channel HuKIV; voltage-gated potassium channel HBK5; voltage-gated potassium channel protein Kv1.2; voltage-gated potassium channel subunit Kv1.2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacagtggccaccggagacccagcagacgaggctgctgccctccctgggcacccacaggacacctatgacccagaggcagaccacgagtgctgtgagagggtggtgatcaacatctcagggctgcggtttgagacccagctaaagaccttagcccagtttccagagaccctcttaggggacccaaagaaacgaatgaggtactttgaccccctccggaatgagtactttttcgatcggaaccgccctagctttgatgccattttgtactactaccagtcagggggccgattgaggcgacctgtgaatgtgcccttagatatattctctgaagaaattcggttttatgagctgggagaagaagcgatggagatgtttcgggaagatgaaggctacatcaaggaggaagagcgtcctctgcctgaaaatgagtttcagagacaagtgtggcttctctttgaatacccagagagctcagggcctgccaggattatagctattgtgtctgtcatggtgattctgatctcaattgtcagcttctgtctggaaacattgcccatcttccgggatgagaatgaagacatgcatggtagtggggtgaccttccacacctattccaacagcaccatcgggtaccagcagtccacttccttcacagaccctttcttcattgtagagacactctgcatcatctggttctcctttgaattcttggtgaggttctttgcctgtcccagcaaagccggcttcttcaccaacatcatgaacatcattgacattgtggccatcatcccctacttcatcaccctggggacagagttggctgagaagccagaggacgctcagcaaggccagcaggccatgtcactggccatcctccgtgtcatccggttggaacgcagacctctgcaaagccagaagagtaagcggggaaggcagcatctgaacacctcacatgactgcaccttaggaattaacctagtcgcgggcatgactgtacagtggaccagggcatctggtcctgatgacaggcagacaccagctgtaactacattgcacaggatgtattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 - SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) - solute carrier family 35 (CMP-sialic acid transporter), member A1 - protein tyrosine phosphatase, non-receptor type 18 (brain-derived) |