KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene View larger

KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC043564
Product type: DNA & cDNA
Ncbi symbol: KCNA2
Origin species: Human
Product name: KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene
Size: 2ug
Accessions: BC043564
Gene id: 3737
Gene description: potassium voltage-gated channel, shaker-related subfamily, member 2
Synonyms: EIEE32; HBK5; HK4; HUKIV; MK2; NGK1; RBK2; potassium voltage-gated channel subfamily A member 2; potassium channel, voltage gated shaker related subfamily A, member 2; potassium voltage-gated channel, shaker-related subfamily, member 2; voltage-gated K(+) channel HuKIV; voltage-gated potassium channel HBK5; voltage-gated potassium channel protein Kv1.2; voltage-gated potassium channel subunit Kv1.2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagtggccaccggagacccagcagacgaggctgctgccctccctgggcacccacaggacacctatgacccagaggcagaccacgagtgctgtgagagggtggtgatcaacatctcagggctgcggtttgagacccagctaaagaccttagcccagtttccagagaccctcttaggggacccaaagaaacgaatgaggtactttgaccccctccggaatgagtactttttcgatcggaaccgccctagctttgatgccattttgtactactaccagtcagggggccgattgaggcgacctgtgaatgtgcccttagatatattctctgaagaaattcggttttatgagctgggagaagaagcgatggagatgtttcgggaagatgaaggctacatcaaggaggaagagcgtcctctgcctgaaaatgagtttcagagacaagtgtggcttctctttgaatacccagagagctcagggcctgccaggattatagctattgtgtctgtcatggtgattctgatctcaattgtcagcttctgtctggaaacattgcccatcttccgggatgagaatgaagacatgcatggtagtggggtgaccttccacacctattccaacagcaccatcgggtaccagcagtccacttccttcacagaccctttcttcattgtagagacactctgcatcatctggttctcctttgaattcttggtgaggttctttgcctgtcccagcaaagccggcttcttcaccaacatcatgaacatcattgacattgtggccatcatcccctacttcatcaccctggggacagagttggctgagaagccagaggacgctcagcaaggccagcaggccatgtcactggccatcctccgtgtcatccggttggaacgcagacctctgcaaagccagaagagtaagcggggaaggcagcatctgaacacctcacatgactgcaccttaggaattaacctagtcgcgggcatgactgtacagtggaccagggcatctggtcctgatgacaggcagacaccagctgtaactacattgcacaggatgtattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
- SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
- solute carrier family 35 (CMP-sialic acid transporter), member A1
- protein tyrosine phosphatase, non-receptor type 18 (brain-derived)

Buy KCNA2-potassium voltage-gated channel, shaker-related subfamily, member 2 Gene now

Add to cart