Login to display prices
Login to display prices
UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene View larger

UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene

PTXBC053576

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene

Proteogenix catalog: PTXBC053576
Ncbi symbol: UGT1A10
Product name: UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene
Size: 2ug
Accessions: BC053576
Gene id: 54575
Gene description: UDP glucuronosyltransferase 1 family, polypeptide A10
Synonyms: UDPGT; UGT-1J; UGT1-10; UGT1.10; UGT1J; UDP-glucuronosyltransferase 1-10; UDP glucuronosyltransferase 1 family, polypeptide A10; UDP glycosyltransferase 1 family, polypeptide A10; UDP-glucuronosyltransferase 1-J; UDP-glucuronosyltransferase 1A10; UDPGT 1-10; UDP glucuronosyltransferase family 1 member A10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcgcgcagggtggaccagccccgttcctttatgtgtgtgtctactgctgacctgtggctttgccgaggcagggaagctgctggtagtgcccatggatgggagtcactggttcaccatgcagtcggtggtggagaaacttatcctcagggggcatgaggtggttgtagtcatgccagaggtgagttggcaactggaaagatcactgaattgcacagtgaagacttactcaacctcgtacactctggaagatcagaaccgggaattcatggttttcgcccatgctcaatggaaagcacaggcacaaagtatattttctctattaatgagttcatccagtggttttcttgacttatttttttcgcattgcaggagtttgtttaatgaccgaaaattagtagaatacttaaaggagagttcttttgatgcagtgtttctggatccttttgatacctgtggcttaattgttgctaaatatttctccctcccctctgtggtcttcaccaggggaatattttgccaccatcttgaagaaggtgcacagtgccctgctcctctttcctatgtccccaatgatctcttagggttctcagatgccatgactttcaaggagagagtatggaaccacatcgtgcacttggaggaccatttattttgccagtatctttttagaaatgccctagaaatagcttctgaaattctccaaacccctgtcacggcatatgatctctacagtcacacatcaatttggttgttgcgaacggactttgttttggactatcccaaacccgtgatgcccaacatgatcttcattggtggtatcaactgtcatcagggaaagccattgcctatggaatttgaagcctacattaatgcttctggagaacatggaattgtggttttctctttgggatcaatggtctcagaaattccagagaagaaagctatggcaattgctgatgctttgggcaaaatccctcagacagtcctgtggcggtacactggaacccgaccatcgaatcttgcgaacaacacgatacttgttaagtggctaccccaaaacgatctgcttggtcacccgatgacccgtgcctttatcacccatgctggttcccatggtgtttatgaaagcatatgcaatggcgttcccatggtgatgatgcccttgtttggtgatcagatggacaatgcaaagcgcatggagactaagggagctggagtgaccctgaatgttctggaaatgacttctgaagatttagaaaatgctctaaaagcagtcatcaatgacaaaagaaagaagcagcagtcaggaagacagatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: