NMUR1-neuromedin U receptor 1 Gene View larger

NMUR1-neuromedin U receptor 1 Gene

PTXBC051914

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NMUR1-neuromedin U receptor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NMUR1-neuromedin U receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051914
Product type: DNA & cDNA
Ncbi symbol: NMUR1
Origin species: Human
Product name: NMUR1-neuromedin U receptor 1 Gene
Size: 2ug
Accessions: BC051914
Gene id: 10316
Gene description: neuromedin U receptor 1
Synonyms: (FM-3); FM-3; FM3; GPC-R; GPR66; NMU1R; neuromedin-U receptor 1; G-protein coupled receptor 66; G-protein coupled receptor FM-3; NMU-R1; neuromedin U receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactcctctctgcctcaattgctctgtcctccctggagacctgtacccagggggtgcaaggaaccccatggcttgcaatggcagtgcggccagggggcactttgaccctgaggacttgaacctgactgacgaggcactgagactcaagtacctggggccccagcagacagagctgttcatgcccatctgtgccacatacctgctgatcttcgtggtgggcgctgtgggcaatgggctgacctgtctggtcatcctgcgccacaaggccatgcgcacgcctaccaactactacctcttcagcctggccgtgtcggacctgctggtgctgctggtgggcctgcccctggagctctatgagatgtggcacaactaccccttcctgctgggcgttggtggctgctatttccgcacgctactgtttgagatggtctgcctggcctcagtgctcaacgtcactgccctgagcgtggaacgctatgtggccgtggtgcacccactccaggccaggtccatggtgacgcgggcccatgtgcgccgagtgcttggggccgtctggggtcttgccatgctctgctccctgcccaacaccagcctgcacggcatccggcagctgcacgtgccctgccggggcccagtgccagactcagctgtttgcatgctggtccgcccacgggccctctacaacatggtagtgcagaccaccgcgctgctcttcttctgcctgcccatggccatcatgagcgtgctctacctgctcattgggctgcgactgcggcgggagaggctgctgctcatgcaggaggccaagggcaggggctctgcagcagccaggtccagatacacctgcaggctccagcagcacgatcggggccggagacaagtgaccaagatgctgtttgtcctggtcgtggtgtttggcatctgctgggccccgttccacgccgaccgcgtcatgtggagcgtcgtgtcacagtggacagatggcctgcacctggccttccagcacgtgcacgtcatctccggcatcttcttctacctgggctcggcggccaaccccgtgctctatagcctcatgtccagccgcttccgagagaccttccaggaggccctgtgcctcggggcctgctgccatcgcctcagaccccgccacagctcccacagcctcagcaggatgaccacaggcagcaccctgtgtgatgtgggctccctgggcagctgggtccaccccctggctgggaacgatggcccagaggcgcagcaagagaccgatccatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - EMI domain containing 1
- paternally expressed 10
- protein kinase C, gamma
- target of myb1 (chicken)

Buy NMUR1-neuromedin U receptor 1 Gene now

Add to cart