Login to display prices
Login to display prices
PEG10-paternally expressed 10 Gene View larger

PEG10-paternally expressed 10 Gene

PTXBC050659

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEG10-paternally expressed 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PEG10-paternally expressed 10 Gene

Proteogenix catalog: PTXBC050659
Ncbi symbol: PEG10
Product name: PEG10-paternally expressed 10 Gene
Size: 2ug
Accessions: BC050659
Gene id: 23089
Gene description: paternally expressed 10
Synonyms: retrotransposon-derived protein PEG10; EDR; HB-1; MEF3L; Mar2; Mart2; RGAG3; MEF3 like 1; embryonal carcinoma differentiation regulated; mammalian retrotransposon-derived protein 2; myelin expression factor 3-like protein 1; paternally expressed gene 10 protein; retrotransposon gag domain-containing protein 3; retrotransposon-derived gag-like polyprotein; ty3/Gypsy-like protein; paternally expressed 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgaacgaagaagggacgagctctctgaagagatcaacaacttaagagagaaggtcatgaagcagtcggaggagaacaacaacctgcagagccaggtgcagaagctcacagaggagaacaccacccttcgagagcaagtggaacccacccctgaggatgaggatgatgacatcgagctccgcggtgctgcagcagctgctgccccaccccctccaatagaggaagagtgcccagaagacctcccagagaagttcgatggcaacccagacatgctggctcctttcatggcccagtgccagatcttcatggaaaagagcaccagggatttctcagttgatcgtgtccgtgtctgcttcgtgacaagcatgatgaccggccgtgctgcccgttgggcctcagcaaagctggagcgctcccactacctgatgcacaactacccagctttcatgatggaaatgaagcatgtctttgaagaccctcagaggcgagaggttgccaaacgcaagatcagacgcctgcgccaaggcatggggtctgtcatcgactactccaatgctttccagatgattgcccaggacctggattggaacgagcctgcgctgattgaccagtaccacgagggcctcagcgaccacattcaggaggagctctcccacctcgaggtcgccaagtcgctgtctgctctgattgggcagtgcattcacattgagagaaggctggccagggctgctgcagctcgcaagccacgctcgccaccccgggcgctggtgttgcctcacattgcaagccaccaccaggtagatccaaccgagccggtgggaggtgcccgcatgcgcctgacgcaggaagaaaaagaaagacgcagaaagctgaacctgtgcctctactgtggaacaggaggtcactacgctgacaattgtcctgccaaggcctcaaagtcttcgccggcgggaaactccccggccccgctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: