Login to display prices
Login to display prices
NUDT13-nudix (nucleoside diphosphate linked moiety X)-type motif 13 Gene View larger

NUDT13-nudix (nucleoside diphosphate linked moiety X)-type motif 13 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT13-nudix (nucleoside diphosphate linked moiety X)-type motif 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT13-nudix (nucleoside diphosphate linked moiety X)-type motif 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC046173
Product type: DNA & cDNA
Ncbi symbol: NUDT13
Origin species: Human
Product name: NUDT13-nudix (nucleoside diphosphate linked moiety X)-type motif 13 Gene
Size: 2ug
Accessions: BC046173
Gene id: 25961
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 13
Synonyms: nucleoside diphosphate-linked moiety X motif 13; nudix (nucleoside diphosphate linked moiety X)-type motif 13; nudix motif 13; nudix hydrolase 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccctgtattgtggaatagcttgcaggagaaaatttttttggtgctataggctgctgtcaacctatgttactaagacacggtatttatttgaactgaaggaagatgatgatgcatgtaaaaaagcccagcaaacaggagcgttttacctctttcatagtctggctcctctgcttcagacttcagcacatcaatacctggccccccggcacagcctgttagagttggaaaggctcctgggtaaatttggacaggatgcacaaagaatagaagattctgtgctgattggatgctctgagcagcaggaagcatggtttgctctggatctaggtctggatagctccttttccataagtgcctccttacacaaacctgaaatggagacagagctcaaggggtctttcattgagctgagaaaggcactctttcaactcaatgcaagggatgcctccttgctgtccacggctcaagctcttctccgctggcatgatgctcatcagttctgcagcagaagtgggcagcccaccaagaagaacgtggctggcagcaagcgtgtgtgcccttccaataatataatctattatccacagatccaggtgaacttgagagaattagagacagctgcctggttcagtcatgatgaggtagccacagccctgaagagaaagggcccctatactcagcaacagaatgggactttcccattctggctgccccctaagttagccatctcccaccaactgattaaggagtgggtggaaaaacagacctgttcttccctgcctgcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Tax1 (human T-cell leukemia virus type I) binding protein 1
- ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
- Tax1 (human T-cell leukemia virus type I) binding protein 3
- ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1