Login to display prices
Login to display prices
PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene View larger

PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene

PTXBC047012

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC047012
Ncbi symbol: PTRH1
Product name: PTRH1-peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC047012
Gene id: 138428
Gene description: peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
Synonyms: C9orf115; PTH1; PTH; peptidyl-tRNA hydrolase 1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggccgggcggctttttgggcgccggacagcggctgagtagagccatgagccgatgtgttttggagcctcgccccccggggaagcggtggatggtggctggcctggggaatcccggactgcccggcacgcgacacagcgtgggcatggcggtgctggggcagctggcgcggcggctgggtgtggcggagagttggacgcgcgaccggcactgtgccgccgacctcgccctggccccgctgggggatgcccaactggtcctgctccggccacggcggcttatgaacgccaacgggcgcagcgtggcccgggctgcggagctgtttgggctgactgccgaggaagtctacctggtgcatgatgagctggacaagcccctggggagactggctctgaagctggggggcagtgccaggggccacaatggagtccgttcctgcattagctgcctcaactccaatgcaatgccaaggctgcgggtgggtatcgggcgcccggcgcaccctgaggcggttcaggcccatgtgctgggctgcttctcccctgctgagcaggagctgctgcctctgttgctggatcgagccaccgacctgatcttggaccacatccgtgagcgaagccaggggccctcactggggccgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: