Login to display prices
Login to display prices
MTIF3-mitochondrial translational initiation factor 3 Gene View larger

MTIF3-mitochondrial translational initiation factor 3 Gene

PTXBC046166

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTIF3-mitochondrial translational initiation factor 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTIF3-mitochondrial translational initiation factor 3 Gene

Proteogenix catalog: PTXBC046166
Ncbi symbol: MTIF3
Product name: MTIF3-mitochondrial translational initiation factor 3 Gene
Size: 2ug
Accessions: BC046166
Gene id: 219402
Gene description: mitochondrial translational initiation factor 3
Synonyms: IF3mt; translation initiation factor IF-3, mitochondrial; IF-3(Mt); mitochondrial translational initiation factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctctttttctaaagaggttaacactacaaactgtaaagtctgaaaatagttgcattagatgttttggtaaacacatcctgcaaaagacagcaccagcacagttgtcccctattgcttctgccccaagactctccttcctaattcatgcaaaagcctttagtaccgctgaagacacccagaatgaaggaaaaaagataaaaaagaataaaacagcttttagtaacgttggaagaaaaattagtcagcgagttattcacttatttgatgagaagggcaatgatttgggaaacatgcaccgagcaaatgtgattagacttatggatgagcgagacctgcgactggttcaaaggaacaccagcacagaacctgcagagtatcagctcatgacaggattgcagatcctccaggagcggcagaggctgagggagatggagaaggcgaaccccaaaactggaccaaccctgagaaaggaactgattttgtcttcaaatattggacaacatgatttggacacaaagactaaacagattcagcagtggattaagaaaaaacacctagtccagattaccataaagaaaggaaaaaatgtagacgtgtcagaaaatgaaatggaggagatatttcatcaaatactccagactatgcctggaatagctacattctcatctaggccacaagctgttcaaggaggaaaagctttaatgtgtgttcttcgtgctttgagcaaaaatgaggagaaggcatataaagaaactcaagagacccaggaaagagacactttgaacaaagaccatggaaatgataaggaatcaaatgttctgcatcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: