MTIF3-mitochondrial translational initiation factor 3 Gene View larger

MTIF3-mitochondrial translational initiation factor 3 Gene

PTXBC046166

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTIF3-mitochondrial translational initiation factor 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTIF3-mitochondrial translational initiation factor 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC046166
Product type: DNA & cDNA
Ncbi symbol: MTIF3
Origin species: Human
Product name: MTIF3-mitochondrial translational initiation factor 3 Gene
Size: 2ug
Accessions: BC046166
Gene id: 219402
Gene description: mitochondrial translational initiation factor 3
Synonyms: IF3mt; translation initiation factor IF-3, mitochondrial; IF-3(Mt); mitochondrial translational initiation factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctctttttctaaagaggttaacactacaaactgtaaagtctgaaaatagttgcattagatgttttggtaaacacatcctgcaaaagacagcaccagcacagttgtcccctattgcttctgccccaagactctccttcctaattcatgcaaaagcctttagtaccgctgaagacacccagaatgaaggaaaaaagataaaaaagaataaaacagcttttagtaacgttggaagaaaaattagtcagcgagttattcacttatttgatgagaagggcaatgatttgggaaacatgcaccgagcaaatgtgattagacttatggatgagcgagacctgcgactggttcaaaggaacaccagcacagaacctgcagagtatcagctcatgacaggattgcagatcctccaggagcggcagaggctgagggagatggagaaggcgaaccccaaaactggaccaaccctgagaaaggaactgattttgtcttcaaatattggacaacatgatttggacacaaagactaaacagattcagcagtggattaagaaaaaacacctagtccagattaccataaagaaaggaaaaaatgtagacgtgtcagaaaatgaaatggaggagatatttcatcaaatactccagactatgcctggaatagctacattctcatctaggccacaagctgttcaaggaggaaaagctttaatgtgtgttcttcgtgctttgagcaaaaatgaggagaaggcatataaagaaactcaagagacccaggaaagagacactttgaacaaagaccatggaaatgataaggaatcaaatgttctgcatcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 168, member A
- family with sequence similarity 113, member A
- nuclear receptor subfamily 2, group E, member 3
- purinergic receptor P2Y, G-protein coupled, 10

Buy MTIF3-mitochondrial translational initiation factor 3 Gene now

Add to cart