FAM168A-family with sequence similarity 168, member A Gene View larger

FAM168A-family with sequence similarity 168, member A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM168A-family with sequence similarity 168, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM168A-family with sequence similarity 168, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC052341
Product type: DNA & cDNA
Ncbi symbol: FAM168A
Origin species: Human
Product name: FAM168A-family with sequence similarity 168, member A Gene
Size: 2ug
Accessions: BC052341
Gene id: 23201
Gene description: family with sequence similarity 168, member A
Synonyms: protein FAM168A; KIAA0280; TCRP1; tongue cancer chemotherapy resistance-associated protein 1; family with sequence similarity 168 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccctgtttacagccccgtgcagcctggggctccttatggcaaccctaagaacatggcctacacgggttaccccacagcctatccagcagctgcccctgcctacaatcccagcctgtaccccaccaatagtcccagttatgctccagcaactctgctgatgaaacaggcctggccacagaactcgtcttcctgtggcactgaaggcaccttccacctcccagtggacaccgggaccgagaaccgaacttaccaagcatcctctgcggctttcagatatactgcggggacaccatacaaggtcccaccgacccagagtaacactgctccacccccctactccccatcacccaacccctatcagacggccatgtatccaatcagaagtgcctacccccagcagaatctgtatgcccagggagcctactacacacagccggtgtatgctgcccagcctcatgtcatccaccataccacggtcgtccagcccaacagcattccctctgctatctacccagcacctgttgccgccccgaggaccaacggtgtggccatgggcatggtggcaggcaccaccatggcaatgtcagcaggtaccctgctgactacaccccagcacacggcgattggggcacaccctgtctccatgccaacatatagggcccaaggaacccctgcgtacagctacgtgcccccacactggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 113, member A
- nuclear receptor subfamily 2, group E, member 3
- purinergic receptor P2Y, G-protein coupled, 10
- cat eye syndrome chromosome region, candidate 1

Buy FAM168A-family with sequence similarity 168, member A Gene now

Add to cart