Login to display prices
Login to display prices
FAM168A-family with sequence similarity 168, member A Gene View larger

FAM168A-family with sequence similarity 168, member A Gene

PTXBC052341

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM168A-family with sequence similarity 168, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM168A-family with sequence similarity 168, member A Gene

Proteogenix catalog: PTXBC052341
Ncbi symbol: FAM168A
Product name: FAM168A-family with sequence similarity 168, member A Gene
Size: 2ug
Accessions: BC052341
Gene id: 23201
Gene description: family with sequence similarity 168, member A
Synonyms: protein FAM168A; KIAA0280; TCRP1; tongue cancer chemotherapy resistance-associated protein 1; family with sequence similarity 168 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccctgtttacagccccgtgcagcctggggctccttatggcaaccctaagaacatggcctacacgggttaccccacagcctatccagcagctgcccctgcctacaatcccagcctgtaccccaccaatagtcccagttatgctccagcaactctgctgatgaaacaggcctggccacagaactcgtcttcctgtggcactgaaggcaccttccacctcccagtggacaccgggaccgagaaccgaacttaccaagcatcctctgcggctttcagatatactgcggggacaccatacaaggtcccaccgacccagagtaacactgctccacccccctactccccatcacccaacccctatcagacggccatgtatccaatcagaagtgcctacccccagcagaatctgtatgcccagggagcctactacacacagccggtgtatgctgcccagcctcatgtcatccaccataccacggtcgtccagcccaacagcattccctctgctatctacccagcacctgttgccgccccgaggaccaacggtgtggccatgggcatggtggcaggcaccaccatggcaatgtcagcaggtaccctgctgactacaccccagcacacggcgattggggcacaccctgtctccatgccaacatatagggcccaaggaacccctgcgtacagctacgtgcccccacactggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: