COMTD1-catechol-O-methyltransferase domain containing 1 Gene View larger

COMTD1-catechol-O-methyltransferase domain containing 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COMTD1-catechol-O-methyltransferase domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COMTD1-catechol-O-methyltransferase domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047774
Product type: DNA & cDNA
Ncbi symbol: COMTD1
Origin species: Human
Product name: COMTD1-catechol-O-methyltransferase domain containing 1 Gene
Size: 2ug
Accessions: BC047774
Gene id: 118881
Gene description: catechol-O-methyltransferase domain containing 1
Synonyms: catechol O-methyltransferase domain-containing protein 1; catechol-O-methyltransferase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccagccggtgccccggctctccgtgcccgccgcgctggccctgggctcagccgcactgggcgccgccttcgccactggcctcttcctggggaggcggtgccccccatggcgaggccggcgagagcagtgcctgcttccccccgaggacagccgcctgtggcagtatcttctgagccgctccatgcgggagcacccggcgctgcgaagcctgaggctgctgaccctggagcagccgcagggggattctatgatgacctgcgagcaggcccagctcttggccaacctggcgcggctcatccaggccaagaaggcgctggacctgggcaccttcacgggctactccgccctggccctggccctggcgctgcccgcggacgggcgcgtggtgacctgcgaggtggacgcgcagcccccggagctgggacggcccctgtggaggcaggccgaggcggagcacaagatcgacctccggctgaagcccgccttggagaccctggacgagctgctggcggcgggcgaggccggcaccttcgacgtggccgtggtggatgcggacaaggagaactgctccgcctactacgagcgctgcctgcagctgctgcgacccggaggcatcctcgccgtcctcagagtcctgtggcgcgggaaggtgctgcaacctccgaaaggggacgtggcggccgagtgtgtgcgaaacctaaacgaacgcatccggcgggacgtcagggtctacatcagcctcctgcccctgggcgatggactcaccttggccttcaagatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)
- ectonucleoside triphosphate diphosphohydrolase 1
- 3'-phosphoadenosine 5'-phosphosulfate synthase 1
- fumarylacetoacetate hydrolase domain containing 1

Buy COMTD1-catechol-O-methyltransferase domain containing 1 Gene now

Add to cart