MBNL3-muscleblind-like 3 (Drosophila) Gene View larger

MBNL3-muscleblind-like 3 (Drosophila) Gene

PTXBC042090

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MBNL3-muscleblind-like 3 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MBNL3-muscleblind-like 3 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC042090
Product type: DNA & cDNA
Ncbi symbol: MBNL3
Origin species: Human
Product name: MBNL3-muscleblind-like 3 (Drosophila) Gene
Size: 2ug
Accessions: BC042090
Gene id: 55796
Gene description: muscleblind-like 3 (Drosophila)
Synonyms: CHCR; MBLX; MBLX39; MBXL; muscleblind-like protein 3; Cys3His CCG1-required protein; muscleblind-like 3; muscleblind-like X-linked protein; muscleblind like splicing regulator 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcgcccagcagatgcagcttatgctccaaaacgctcaaatgtcatcacttggttcttttcctatgactccatcaattccagctaatcctcccatggctttcaatccttacataccacatcctgggatgggcctcgttcctgcagaacttgtaccaaatacacctgttctgattcctggaaacccacctcttgcaatgccaggagctgttggcccaaaactgatgcgttcagataaactggaggtttgccgagaatttcagcgtggaaattgtacccgtggggagaatgattgccgctatgctcaccctactgatgcttccatgattgaagcgagtgataatactgtgacaatctgcatggattacatcaaaggtcgatgctcgcgggagaaatgcaagtactttcatcctcctgcacacttgcaagccagactcaaggcagctcatcatcagatgaaccattcagctgcctctgccatggccctgcagcctggtacactgcaactgataccaaagagatcagcactggaaaagcccaatggtgccaccccggtctttaatcccactgttttccactgccaacaggctctgactaacctgcagctcccacagccggcatttatccctgcagggccaatactgtgcatggcacccgcttcaaatattgtgcccatgatgcacggtgctacacctaccactgtgtctgcagcaacaacacctgccaccagcgttccgttcgctgcaccaactacaggcaatcagctgaaattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - abhydrolase domain containing 7
- SAM and SH3 domain containing 3
- RAS-like, family 10, member A
- ubiquitin specific peptidase 15

Buy MBNL3-muscleblind-like 3 (Drosophila) Gene now

Add to cart