ABHD7-abhydrolase domain containing 7 Gene View larger

ABHD7-abhydrolase domain containing 7 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABHD7-abhydrolase domain containing 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ABHD7-abhydrolase domain containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC041475
Product type: DNA & cDNA
Ncbi symbol: ABHD7
Origin species: Human
Product name: ABHD7-abhydrolase domain containing 7 Gene
Size: 2ug
Accessions: BC041475
Gene id: 253152
Gene description: abhydrolase domain containing 7
Synonyms: ABHD7; EH4; EPHXRP; epoxide hydrolase 4; abhydrolase domain containing 7; abhydrolase domain-containing protein 7; epoxide hydrolase-related protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaggctgcgggattgcctgccccgcctgatgctcacgctccggtccctgctcttctggtccctggtctactgctactgcgggctctgcgcctccatccacctgctcaaacttttgtggagcctcggcaaggggccggcgcagaccttccggcggcccgcccgggagcaccctcccgcgtgcctgagcgacccctccttgggcacccactgctacgtgcggatcaaggattcagggttaagatttcactatgttgctgctggagaaagaggcaaaccacttatgctgctgcttcatggatttccagaattctggtattcttggcgttaccaactgagagaatttaaaagtgaatatcgagttgtagcactggatttgagaggttatggagaaacagatgctcccattcatcgacagaattataaattggattgtctaattacagatataaaggatattttagattctttagggtatagcaaatgtgttcttattggccatgactgggggggcatgattgcttggctaattgccatctgttatcctgaaatggtgatgaagcttattgttattaacttccctcatccaaatgtatttacagaatatattttacgacaccctgctcagctgttgaaatccagttattattacttcttccaaataccatggttcccagaatttatgttctcaataaatgatttcaaggttttgaaacatctgtttaccagtcacagcactggcattggaagaaaaggatgccaattaacaacagaggatcttgaagcttatatttatgtcttttctcagcctggagcattaagtggcccaattaaccattaccgaaatatcttcagctgcctgcctctcaaacatcacatggtgaccactccaacactactactgtggggagagaatgacgcattcatggaggttgagatggctgaagtcacaaagatttttgttaaaaactatttcaggctaactattttgtcagaagccagtcattggcttcagcaagaccaacctgacatagtgaacaaattgatatggacatttctaaaagaagaaacaagaaaaaaagattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SAM and SH3 domain containing 3
- RAS-like, family 10, member A
- ubiquitin specific peptidase 15
- methionine sulfoxide reductase A

Buy ABHD7-abhydrolase domain containing 7 Gene now

Add to cart