NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene View larger

NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene

PTXBC047666

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047666
Product type: DNA & cDNA
Ncbi symbol: NAT1
Origin species: Human
Product name: NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene
Size: 2ug
Accessions: BC047666
Gene id: 9
Gene description: N-acetyltransferase 1 (arylamine N-acetyltransferase)
Synonyms: AAC1; MNAT; NAT-1; NATI; arylamine N-acetyltransferase 1; N-acetyltransferase 1 (arylamine N-acetyltransferase); N-acetyltransferase type 1; arylamide acetylase 1; monomorphic arylamine N-acetyltransferase; N-acetyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacattgaagcatatcttgaaagaattggctataagaagtctaggaacaaattggacttggaaacattaactgacattcttcaacaccagatccgagctgttccctttgagaaccttaacatccattgtggggatgccatggacttaggcttagaggccatttttgatcaagttgtgagaagaaatcggggtggatggtgtctccaggtcaatcatcttctgtactgggctctgaccactattggttttgagaccacgatgttgggagggtatgtttacagcactccagccaaaaaatacagcactggcatgattcaccttctcctgcaggtgaccattgatggcaggaactacattgtcgatgctgggtttggacgctcataccagatgtggcagcctctggagttaatttctgggaaggatcagcctcaggtgccttgtgtcttccgtttgacggaagagaatggattctggtatctagaccaaatcagaagggaacagtacattccaaatgaagaatttcttcattctgatctcctagaagacagcaaataccgaaaaatctactcctttactcttaagcctcgaacaattgaagattttgagtctatgaatacatacctgcagacatctccatcatctgtgtttactagtaaatcattttgttccttgcagaccccagatggggttcactgtttggtgggcttcaccctcacccataggagattcaattataaggacaatacagatctaatagagttcaagactctgagtgaggaagaaatagaaaaagtgctgaaaaatatatttaatatttccttgcagagaaagcttgtgcccaaacatggtgatagattttttactatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ST3 beta-galactoside alpha-2,3-sialyltransferase 3
- vacuolar protein sorting 4 homolog A (S. cerevisiae)
- karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
- staufen, RNA binding protein, homolog 1 (Drosophila)

Buy NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene now

Add to cart