Login to display prices
Login to display prices
NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene View larger

NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene

PTXBC047666

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene

Proteogenix catalog: PTXBC047666
Ncbi symbol: NAT1
Product name: NAT1-N-acetyltransferase 1 (arylamine N-acetyltransferase) Gene
Size: 2ug
Accessions: BC047666
Gene id: 9
Gene description: N-acetyltransferase 1 (arylamine N-acetyltransferase)
Synonyms: AAC1; MNAT; NAT-1; NATI; arylamine N-acetyltransferase 1; N-acetyltransferase 1 (arylamine N-acetyltransferase); N-acetyltransferase type 1; arylamide acetylase 1; monomorphic arylamine N-acetyltransferase; N-acetyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacattgaagcatatcttgaaagaattggctataagaagtctaggaacaaattggacttggaaacattaactgacattcttcaacaccagatccgagctgttccctttgagaaccttaacatccattgtggggatgccatggacttaggcttagaggccatttttgatcaagttgtgagaagaaatcggggtggatggtgtctccaggtcaatcatcttctgtactgggctctgaccactattggttttgagaccacgatgttgggagggtatgtttacagcactccagccaaaaaatacagcactggcatgattcaccttctcctgcaggtgaccattgatggcaggaactacattgtcgatgctgggtttggacgctcataccagatgtggcagcctctggagttaatttctgggaaggatcagcctcaggtgccttgtgtcttccgtttgacggaagagaatggattctggtatctagaccaaatcagaagggaacagtacattccaaatgaagaatttcttcattctgatctcctagaagacagcaaataccgaaaaatctactcctttactcttaagcctcgaacaattgaagattttgagtctatgaatacatacctgcagacatctccatcatctgtgtttactagtaaatcattttgttccttgcagaccccagatggggttcactgtttggtgggcttcaccctcacccataggagattcaattataaggacaatacagatctaatagagttcaagactctgagtgaggaagaaatagaaaaagtgctgaaaaatatatttaatatttccttgcagagaaagcttgtgcccaaacatggtgatagattttttactatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: