ST3GAL3-ST3 beta-galactoside alpha-2,3-sialyltransferase 3 Gene View larger

ST3GAL3-ST3 beta-galactoside alpha-2,3-sialyltransferase 3 Gene

PTXBC050380

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ST3GAL3-ST3 beta-galactoside alpha-2,3-sialyltransferase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ST3GAL3-ST3 beta-galactoside alpha-2,3-sialyltransferase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050380
Product type: DNA & cDNA
Ncbi symbol: ST3GAL3
Origin species: Human
Product name: ST3GAL3-ST3 beta-galactoside alpha-2,3-sialyltransferase 3 Gene
Size: 2ug
Accessions: BC050380
Gene id: 6487
Gene description: ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Synonyms: EIEE15; MRT12; SIAT6; ST3GALII; ST3GalIII; ST3N; CMP-N-acetylneuraminate-beta-1,4-galactoside alpha-2,3-sialyltransferase; Gal beta-1,3(4)GlcNAc alpha-2,3 sialyltransferase; ST3Gal III; alpha 2,3-ST 3; alpha 2,3-sialyltransferase III; alpha-2,3-sialyltransferase II; mental retardation, non-syndromic, autosomal recessive, 12; sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase); ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggactcttggtatttgtgcgcaatctgctgctagccctctgcctctttctggtactgggatttttgtattattctgcgtggaagctacacttactccagtgggaggaggactccaattcagtggttctttcctttgactccgctggacaaacactaggctcagagtatgatcggttgggcttcctcctgaatctggactctaaactgcctgctgaattagccaccaagtacgcaaacttttcagagggagcttgcaagcctggctatgcttcagccttgatgacggccatcttcccccggttctccaagccagcacccatgttcctggatgactcctttcgcaagtgggctagaatccgggagttcgtgccgccttttgggatcaaaggtcaagacaatctgatcaaagccatcttgtcagtcaccaaagagtaccgcctgacccctgccttggacagcctccgctgccgccgctgcatcatcgtgggcaatggaggcgttcttgccaacaagtctctggggtcacgaattgacgactatgacattgtggtgagactgaattcagcaccagtgaaaggctttgagaaggacgtgggcagcaaaacgacactgcgcatcacctaccccgagggcgccatgcagcggcctgagcagtacgagcgcgattctctctttgtcctcgccggcttcaagtggcaggactttaagtggttgaaatacatcgtctacaaggagagagtgagtgcatcggatggcttctggaaatctgtggccactcgagtgcccaaggagccccctgagattcgaatcctcaacccatatttcatccaggaggccgccttcaccctcattggcctgcccttcaacaatggcctcatgggccgggggaacatccctacccttggcagtgtggcagtgaccatggcactacacggctgtgacgaggtggcagtcgcaggatttggctatgacatgagcacacccaacgcacccctgcactactatgagaccgttcgcatggcagccatcaaagagtcctggacgcacaatatccagcgagagaaagagtttctgcggaagctggtgaaagctcgcgtcatcactgatctaagcagtggcatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vacuolar protein sorting 4 homolog A (S. cerevisiae)
- karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
- staufen, RNA binding protein, homolog 1 (Drosophila)
- ATP-binding cassette, sub-family F (GCN20), member 3

Buy ST3GAL3-ST3 beta-galactoside alpha-2,3-sialyltransferase 3 Gene now

Add to cart