STX12-syntaxin 12 Gene View larger

STX12-syntaxin 12 Gene

PTXBC046999

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STX12-syntaxin 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STX12-syntaxin 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC046999
Product type: DNA & cDNA
Ncbi symbol: STX12
Origin species: Human
Product name: STX12-syntaxin 12 Gene
Size: 2ug
Accessions: BC046999
Gene id: 23673
Gene description: syntaxin 12
Synonyms: STX13; STX14; syntaxin-12; syntaxin 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcatacggtcccttagacatgtaccggaacccggggccctcggggccccagctccgggacttcagcagcatcatccagacgtgcagcggcaacatccagcggatcagccaagccactgctcagataaagaatttgatgagccagctaggaactaagcaggactcaagcaagctacaggaaaatctgcaacagttacaacactccacaaatcagctcgccaaggaaacaaatgaattgctgaaagaattagggtccttgccccttcccttatctacttcagaacagcgccagcagagacttcagaaggaacgcctcatgaatgacttctctgcagccttaaacaatttccaggctgtgcagagaagggtatctgaaaaggaaaaggagagtattgccagagcaagagctggatctcgtctttctgcagaagagaggcaaagagaggagcagctggtctcatttgacagccatgaggagtggaaccagatgcagagccaggaggatgaggtggccatcactgagcaggatttggaacttattaaagaaagagaaacggcaattcggcagctggaggctgacattttggatgtcaatcagatatttaaagatttggccatgatgatccatgaccagggtgatctgattgatagcatagaagccaatgtggaaagctcagaggtgcacgtcgaaagagccactgaacagttacagcgagctgcttactatcagaaaaaatctcgcaagaagatgtgtatcctggtgcttgtcctgtcagtgattattctaatcttgggacttattatctggctagtttataaaacgaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vasohibin 2
- vasohibin 1
- gastrokine 1
- homeobox C9

Buy STX12-syntaxin 12 Gene now

Add to cart