VASH2-vasohibin 2 Gene View larger

VASH2-vasohibin 2 Gene

PTXBC051856

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VASH2-vasohibin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VASH2-vasohibin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051856
Product type: DNA & cDNA
Ncbi symbol: VASH2
Origin species: Human
Product name: VASH2-vasohibin 2 Gene
Size: 2ug
Accessions: BC051856
Gene id: 79805
Gene description: vasohibin 2
Synonyms: vasohibin-2; testicular tissue protein Li 222; vasohibin-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccggctccgcggccgacactcaccgctgcccccaccccaaaggcgccaaaggcacccggtcccggagcagccacgcgcggcccgtgagcctcgccaccagcgggggctcagaggaggaggacaaagacggcggggtgctgttccacgtcaacaagagcggcttccccatcgacagccacacctgggagcgcatgtggatgcacgtggccaaggtgcaccctaaggggggagaaatggtgggcgccatcaggaacgccgccttcttggcaaagccttcaataccccaggtcccaaactacaggctgtcgatgacgatcccagactggctccaggcgatccagaattacatgaagaccctacactacttaaccaatgggcagccttccattgagcggttccccatcagctttaaaacctacttctcaggaaactactttcaccacgttgtgctggggatttactgcaatggccgctatggctcattgggcatgagccgcagggctgagctgatggacaagccattgacttttcggactctgagtgacctcatctttgactttgaggactcttacaagaaatacctgcacacagtcaagaaggtcaagattgggctgtacgtcccccatgagcctcatagcttccagcccattgagtggaagcagctggtcctcaacgtctcaaagatgctgagggctgacataaggaaggagctggagaaatatgccagggacatgagaatgaagatcctgaaacctgcaagtgcccactctccgacccaagtgagaagccggggaaaatccctgtcccccagaaggagacaggcaagccccccgaggaggctcggccggcgagagaagtcgcctgcactgcctgaaaagaaggtggctgatctgagcactctgaatgaagtgggctatcaaatccgaatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vasohibin 1
- gastrokine 1
- homeobox C9
- KIAA1984

Buy VASH2-vasohibin 2 Gene now

Add to cart