Login to display prices
Login to display prices
PACRG-PARK2 co-regulated Gene View larger

PACRG-PARK2 co-regulated Gene

PTXBC044227

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PACRG-PARK2 co-regulated Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PACRG-PARK2 co-regulated Gene

Proteogenix catalog: PTXBC044227
Ncbi symbol: PACRG
Product name: PACRG-PARK2 co-regulated Gene
Size: 2ug
Accessions: BC044227
Gene id: 135138
Gene description: PARK2 co-regulated
Synonyms: GLUP; HAK005771; PARK2CRG; parkin coregulated gene protein; PARK2 co-regulated; molecular chaperone/chaperonin-binding protein; parkin co-regulated gene protein; PARK2 coregulated
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggcagaaaaagagaccctgagcttaaacaaatgcccagacaagatgccgaagaggaccaagctgctggcacaacagccgctcccggtgcaccagcctcactctctggtttctgagggtttcacagtcaaagccatgatgaaaaactcagtcgtgagaggccctccagctgcaggggcatttaaagaaagaccaaccaagcccacagcatttcgaaaattctatgagcgaggtgacttcccaattgcccttgagcatgattcgaaaggaaacaaaatcgcctggaaggtagaaattgagaagctggattaccatcattatctgcctctgttttttgatgggctttgtgaaatgacatttccctatgagttttttgctcggcaaggaatccacgacatgctggaacacggtgggaacaagatcctacctgtccttccacagctcattatcccgataaaaaatgccttgaacctccgaaaccgacaggtcatctgtgtcactctcaaggtcctccagcatctggttgtgtcagctgagatggtgggcaaggccttggtgccttattaccgtcaaatcctccctgtcctgaacatctttaagaatatgaatgtgaactccggagacggcattgactacagccagcagaagagggagaacattggggacttgatccaggagacactggaggccttcgagcgctacggaggagaaaatgcctttatcaacattaagtacgtggtcccaacctacgagtcttgcttgctaaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: