Login to display prices
Login to display prices
CBX7-chromobox homolog 7 Gene View larger

CBX7-chromobox homolog 7 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CBX7-chromobox homolog 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CBX7-chromobox homolog 7 Gene

Proteogenix catalog: PTXBC051773
Ncbi symbol: CBX7
Product name: CBX7-chromobox homolog 7 Gene
Size: 2ug
Accessions: BC051773
Gene id: 23492
Gene description: chromobox homolog 7
Synonyms: chromobox protein homolog 7; chromobox 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgtcagccatcggcgagcaggtgttcgccgtggagagcatccggaagaagcgcgtgcggaagggtaaagtcgagtatctggtgaagtggaaaggatggcccccaaagtacagcacgtgggagccagaagagcacatcttggacccccgcctcgtcatggcctacgaggagaaggaggagagagaccgagcatcggggtataggaagagaggtccgaaacccaggcggcttctgctgcagcggctgtacagcatggacctgcggagctcccacaaggccaagggcaaggagaagctctgcttctccctgacgtgcccactcggcagcgggagccctgagggggtggtcaaggcgggggcacctgagctggtggacaagggccccttggtgcccaccctgcccttcccgctccgcaagccccgaaaggcccacaagtacctgcggctctcgcgcaagaagttcccgccccgcgggcccaacctggagagccacagccatcgacgggagctcttcctgcaggagccaccggccccagacgtcctgcaggcggctggcgagtgggagcctgctgcgcagccccctgaagaggaggcagatgccgacctggccgaggggccccctccctggacacctgcgctcccctcaagtgaggtgaccgtgaccgacatcaccgccaactccatcaccgtcaccttccgcgaggcccagccagctgagggcttcttccgagaccgcagtgggaagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: