RAB17-RAB17, member RAS oncogene family Gene View larger

RAB17-RAB17, member RAS oncogene family Gene

PTXBC050426

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB17-RAB17, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB17-RAB17, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050426
Product type: DNA & cDNA
Ncbi symbol: RAB17
Origin species: Human
Product name: RAB17-RAB17, member RAS oncogene family Gene
Size: 2ug
Accessions: BC050426
Gene id: 64284
Gene description: RAB17, member RAS oncogene family
Synonyms: RAB17, member RAS oncogene family; ras-related protein Rab-17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacaggcacacaggaccccccagcccagggctgcccccagccagccccgtgtgttcaagctggttctcctgggaagtggctccgtgggtaagtccagcttggctcttcggtacgtgaagaacgacttcaagagtatcctgcctacggtgggctgtgcgttcttcacaaaggtggtggatgtgggtgccacctctctgaagcttgagatctgggacacagctggccaggagaagtaccacagcgtctgccacctctacttcaggggtgccaacgctgcgcttctggtgtacgacatcaccaggaaggattccttcctcaaggctcagcagtggctgaaggacctggaggaggagctgcacccaggagaagtcctggtgatgctggtgggcaacaagacggacctcagccaggagcgggaggtgaccttccaggaagggaaggagtttgccgacagccagaagttgctgttcatggaaacttcggccaaactgaaccaccaggtgtcggaggtgttcaatacagtggcccaagagctactgcagagaagcgacgaggagggccaggctctacggggggatgcagctgtggctctgaacaaggggcccgcgaggcaggccaaatgctgcgcccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methionine sulfoxide reductase B3
- lymphoid enhancer-binding factor 1
- mitochondrial fission regulator 1
- adenylosuccinate synthase like 1

Buy RAB17-RAB17, member RAS oncogene family Gene now

Add to cart