Login to display prices
Login to display prices
MSRB3-methionine sulfoxide reductase B3 Gene View larger

MSRB3-methionine sulfoxide reductase B3 Gene

PTXBC040053

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MSRB3-methionine sulfoxide reductase B3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MSRB3-methionine sulfoxide reductase B3 Gene

Proteogenix catalog: PTXBC040053
Ncbi symbol: MSRB3
Product name: MSRB3-methionine sulfoxide reductase B3 Gene
Size: 2ug
Accessions: BC040053
Gene id: 253827
Gene description: methionine sulfoxide reductase B3
Synonyms: DFNB74; methionine-R-sulfoxide reductase B3; methionine-R-sulfoxide reductase B3, mitochondrial; methionine sulfoxide reductase B3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgcattcaacctgctgcatttggtgacaaagagccagccagtagcccttcgagcctgtgggcttccctcagggtcgtgtagggataaaaagaactgtaaggtggtcttttcccagcaggaactgaggaagcggctaacacccctgcagtaccatgtcactcaggagaaagggaccgaaagtgcctttgaaggagaatacacacatcacaaagatcctggaatatataaatgtgttgtttgtggaactccattgtttaagtcagaaaccaaatttgactccggttcaggttggccttcattccacgatgtgatcaattctgaggcaatcacattcacagatgacttttcctatgggatgcacagggtggaaacaagctgctctcagtgtggtgctcaccttgggcacatttttgatgatgggcctcgtccaactgggaaaagatactgcataaattcggctgccttgtcttttacacctgcggatagcagtggcaccgccgagggaggcagtggggtcgccagcccggcccaggcagacaaagcggagctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: