SPCS3-signal peptidase complex subunit 3 homolog (S. cerevisiae) Gene View larger

SPCS3-signal peptidase complex subunit 3 homolog (S. cerevisiae) Gene

PTXBC047290

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPCS3-signal peptidase complex subunit 3 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPCS3-signal peptidase complex subunit 3 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047290
Product type: DNA & cDNA
Ncbi symbol: SPCS3
Origin species: Human
Product name: SPCS3-signal peptidase complex subunit 3 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC047290
Gene id: 60559
Gene description: signal peptidase complex subunit 3 homolog (S. cerevisiae)
Synonyms: PRO3567; SPC22/23; SPC3; YLR066W; signal peptidase complex subunit 3; SPase 22 kDa subunit; SPase 22/23 kDa subunit; microsomal signal peptidase 22/23 kDa subunit; microsomal signal peptidase 23 kDa subunit; signal peptidase complex subunit 3 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacacggtgctgtcgcgggcgaactcactgttcgccttctcgctgagcgtgatggcggcgctcaccttcggctgcttcatcaccaccgccttcaaagacaggagcgtcccggtgcggctgcacgtctcgcggatcatgctaaaaaatgtagaagatttcactggacctagagaaagaagtgatctgggatttatcacatttgatataactgctgatctagagaatatatttgattggaatgttaagcagttgtttctttatttatcagcagaatattcaacaaaaaataatgctctgaaccaagttgtcctatgggacaagattgttttgagaggtgataatccgaagctgctgctgaaagatatgaaaacaaaatattttttctttgacgatggaaatggtctcaagggaaacaggaatgtcactttgaccctgtcttggaacgtcgtaccaaatgctggaattctacctcttgtgacaggatcaggacacgtatctgtcccatttccagatacatatgaaataacgaagagttattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein, Y-linked, family 1, member A1
- ankyrin repeat and sterile alpha motif domain containing 3
- signal peptidase complex subunit 2 homolog (S. cerevisiae)
- ankyrin repeat and sterile alpha motif domain containing 6

Buy SPCS3-signal peptidase complex subunit 3 homolog (S. cerevisiae) Gene now

Add to cart