RBMY1A1-RNA binding motif protein, Y-linked, family 1, member A1 Gene View larger

RBMY1A1-RNA binding motif protein, Y-linked, family 1, member A1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBMY1A1-RNA binding motif protein, Y-linked, family 1, member A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBMY1A1-RNA binding motif protein, Y-linked, family 1, member A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047768
Product type: DNA & cDNA
Ncbi symbol: RBMY1A1
Origin species: Human
Product name: RBMY1A1-RNA binding motif protein, Y-linked, family 1, member A1 Gene
Size: 2ug
Accessions: BC047768
Gene id: 5940
Gene description: RNA binding motif protein, Y-linked, family 1, member A1
Synonyms: RBM; RBM1; RBM2; RBMY; RBMY1C; YRRM1; YRRM2; RNA-binding motif protein, Y chromosome, family 1 member A1; RNA-binding motif protein 2; RNA-binding motif protein, Y chromosome, family 1 member A1/C; Y chromosome RNA recognition motif 1; Y chromosome RNA recognition motif 2; RNA binding motif protein, Y-linked, family 1, member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttattctaggggactcattccagttaaaagaggtccatcttcaagaagtggaggtcctcctccgaaaaaatctgctccttctgctgtggcaagaagcaatagttggatgggaagccaaggtcccatgtcacaaagaagagagaattatggagttcctccacgcagagcgacaatatcttcctggagaaatgatcgcatgtcaacaagacatgatggttatgcaactaacgatggaaatcatccaagttgccaagaaacgagggattatgctccaccatctagaggctatgcataccgtgataatggtcattctaatcgggatgaacattcctctagaggatatagaaatcatcgaagttcccgagaaactagggattatgctccaccatctagaggccatgcataccgtgattatggtcattctcgtcgggatgaaagttattctagaggatacagaaatcgtcgaagttcccgagaaactagggagtatgctccaccatctagaggccatggataccgtgattatggtcattctcgtcgacatgaaagttattctagaggatatagaaatcatccaagttcccgagaaaccagggattatgctccaccacatagagactatgcataccgtgattatggtcattctagttgggatgaacattcctctagaggatatagttatcatgatggctacggtgaggcccttggtagagatcattctgaacatctaagtggaagttcttatagagatgcacttcagagatacgggacctctcatggtgcaccacctgcaagagggcctcggatgtcttatggtggaagcacctgccacgcatatagtaatacacgagatagatatggcagaagttgggagagttactcgagctgtggtgattttcattattgtgatcgtgagcatgtttgcagaaaagaccaaaggaatccgccttctctgggtagggtgctccctgatcctcgtgaagcatgtggtagctcaagttatgtggcatctatagtagatggtggggagagtcgatctgaaaaaggagactcgagcagatattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and sterile alpha motif domain containing 3
- signal peptidase complex subunit 2 homolog (S. cerevisiae)
- ankyrin repeat and sterile alpha motif domain containing 6
- polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa

Buy RBMY1A1-RNA binding motif protein, Y-linked, family 1, member A1 Gene now

Add to cart