Login to display prices
Login to display prices
ARGLU1-arginine and glutamate rich 1 Gene View larger

ARGLU1-arginine and glutamate rich 1 Gene

PTXBC050434

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARGLU1-arginine and glutamate rich 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARGLU1-arginine and glutamate rich 1 Gene

Proteogenix catalog: PTXBC050434
Ncbi symbol: ARGLU1
Product name: ARGLU1-arginine and glutamate rich 1 Gene
Size: 2ug
Accessions: BC050434
Gene id: 55082
Gene description: arginine and glutamate rich 1
Synonyms: arginine and glutamate-rich protein 1; arginine and glutamate rich 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccggtctcggagccggagctcgtcccgctccaagcacaccaagagcagcaagcacaacaagaagcgcagccggtcccggtcgcgatcccgggacaaggagcgcgtgcggaagcgttccaaatctcgggaaagtaaacggaaccggcggcgggagtcgcggtcccgttcgcgctccaccaacacggccgtgtcccggcgcgagcgggaccgggagcgcgcctcgtccccgcccgaccgcatcgacatcttcgggcgcacggtgagcaagcgcagcagcctggacgagaagcagaagcgagaggaggaggagaagaaagcggagttcgagcggcagcgaaaaattcgacagcaagaaatagaagaaaaactcatcgaggaagaaacagcacgaagagtagaagaattggtagcaaaaagggtggaggaagaactggagaaaaggaaggatgaaattgaacgagaagttctccgaagggtggaggaagccaaacgcatcatggaaaagcagttgctcgaagaactcgagcgacagagacaagctgagcttgccgcacaaaaagctagagaggaggaagaacgtgcaaaacgtgaggagctagagcgaatactggaagagaataaccgaaaaattgcagaagcacaagccaaactggccgaagaacagttgagaattgttgaagaacaaagaaagattcatgaggaaaggatgaaactagaacaagaacgacaacgtcaacaaaaagaagaacaaaaaattatcctgggcaaggggaagtccaggccaaaactgtccttctcattaaaaacccaggattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice