ARGLU1-arginine and glutamate rich 1 Gene View larger

ARGLU1-arginine and glutamate rich 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARGLU1-arginine and glutamate rich 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARGLU1-arginine and glutamate rich 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050434
Product type: DNA & cDNA
Ncbi symbol: ARGLU1
Origin species: Human
Product name: ARGLU1-arginine and glutamate rich 1 Gene
Size: 2ug
Accessions: BC050434
Gene id: 55082
Gene description: arginine and glutamate rich 1
Synonyms: arginine and glutamate-rich protein 1; arginine and glutamate rich 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccggtctcggagccggagctcgtcccgctccaagcacaccaagagcagcaagcacaacaagaagcgcagccggtcccggtcgcgatcccgggacaaggagcgcgtgcggaagcgttccaaatctcgggaaagtaaacggaaccggcggcgggagtcgcggtcccgttcgcgctccaccaacacggccgtgtcccggcgcgagcgggaccgggagcgcgcctcgtccccgcccgaccgcatcgacatcttcgggcgcacggtgagcaagcgcagcagcctggacgagaagcagaagcgagaggaggaggagaagaaagcggagttcgagcggcagcgaaaaattcgacagcaagaaatagaagaaaaactcatcgaggaagaaacagcacgaagagtagaagaattggtagcaaaaagggtggaggaagaactggagaaaaggaaggatgaaattgaacgagaagttctccgaagggtggaggaagccaaacgcatcatggaaaagcagttgctcgaagaactcgagcgacagagacaagctgagcttgccgcacaaaaagctagagaggaggaagaacgtgcaaaacgtgaggagctagagcgaatactggaagagaataaccgaaaaattgcagaagcacaagccaaactggccgaagaacagttgagaattgttgaagaacaaagaaagattcatgaggaaaggatgaaactagaacaagaacgacaacgtcaacaaaaagaagaacaaaaaattatcctgggcaaggggaagtccaggccaaaactgtccttctcattaaaaacccaggattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PHD finger protein 20-like 1
- polymerase (DNA directed) kappa
- EFR3 homolog B (S. cerevisiae)
- UDP-glucose pyrophosphorylase 2

Buy ARGLU1-arginine and glutamate rich 1 Gene now

Add to cart