PHF20L1-PHD finger protein 20-like 1 Gene View larger

PHF20L1-PHD finger protein 20-like 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHF20L1-PHD finger protein 20-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PHF20L1-PHD finger protein 20-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050655
Product type: DNA & cDNA
Ncbi symbol: PHF20L1
Origin species: Human
Product name: PHF20L1-PHD finger protein 20-like 1 Gene
Size: 2ug
Accessions: BC050655
Gene id: 51105
Gene description: PHD finger protein 20-like 1
Synonyms: tudor domain-containing protein PHF20L1; CGI-72; TDRD20B; URLC1; PHD finger protein 20-like protein 1; tudor domain containing 20B; up-regulated in lung cancer 1; PHD finger protein 20-like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatccagtgtgaagagtgcttgtgttggcaacacagcgtgtgcatggggctgctggaggagagcattccagagcagtacatctgctatatctgccgggacccaccaggtcagaggtggagtgcaaaatatcgttatgataaggagtggttgaataatgggagaatgtgcgggttatcatttttcaaagaaaattattctcatctcaatgccaaaaagatagtttctacacatcacctgcttgctgatgtctatggtgttacagaagtgctacacgggctacagctgaagattggaatactaaagaataaacatcatcctgaccttcatctctgggcttgttccgggaagcgaaaagaccaagatcaaataatagctggggtggagaaaaaaatagctcaagacacagttaatcgagaagaaaagaaatatgtacagaaccataaagaaccacctcgtttgcccctaaaaatggaaggaacttatataacaagtgagcatagctatcaaaagccacaaagttttggtcaggactgtaaatctctcgcagaccctgggagctcagatgatgatgatgttagtagtttggaagaagaacaagaattccacatgagaagtaaaaacagtttacagtactcagcaaaagaacatggaatgcctgaaaagaatccagctgaagggaatacagtatttgtttataatgataaaaagggcaccgaagacccaggagactcacatcttcagtggcagctcaatctccttacacacatagaaaatgtgcagaacgaagttaccagcaggatggacctaatagaaaaagaagtcgatgttctggaaagctggcttgatttcacaggggagttggagccaccagatcctcttgcaagattgccccaacttaaacgccacataaaacagctcctaattgacatgggcaaagtacagcagatagcaactctttgctctgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polymerase (DNA directed) kappa
- EFR3 homolog B (S. cerevisiae)
- UDP-glucose pyrophosphorylase 2
- virus-induced signaling adapter

Buy PHF20L1-PHD finger protein 20-like 1 Gene now

Add to cart