Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ITM2C-integral membrane protein 2C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ITM2C-integral membrane protein 2C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050668 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ITM2C |
| Origin species: | Human |
| Product name: | ITM2C-integral membrane protein 2C Gene |
| Size: | 2ug |
| Accessions: | BC050668 |
| Gene id: | 81618 |
| Gene description: | integral membrane protein 2C |
| Synonyms: | BRI3; BRICD2C; E25; E25C; ITM3; integral membrane protein 2C; BRICHOS domain containing 2C; cerebral protein 14; integral membrane protein 3; transmembrane protein BRI3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgaagattagcttccagcccgccgtggctggcatcaagggcgacaaggctgacaaggcgtcggcgtcggcccctgcgccggcctcggccaccgagatcctgctgacgccggctaggctggcccgagataacttcttccgctgtggtgtgctgtatgaggactccctgtcctcccaggtccggactcagatggagctggaagaggatgtgaaaatctacctcgacgagaactacgagcgcatcaacgtgcctgtgccccagtttggcggcggtgaccctgcagacatcatccatgacttccagcggggtctgactgcgtaccatgatatctccctggacaagtgctatgtcatcgaactcaacaccaccattgtgctgccccctcgcaacttctgggagctcctcatgaacgtgaagagggggacctacctgccgcagacgtacatcatccaggaggagatggtggtcacggagcatgtcagtgacaaggaggccctggggtccttcatctaccacctgtgcaacgggaaagacacctaccggctccggcgccgggcaacgcggaggcggatcaacaagcgtggggccaagaactgcaatgccatccgccacttcgagaacaccttcgtggtggagacgctcatctgcggggtggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polycomb group ring finger 5 - mitochondrial protein 18 kDa - YTH domain family, member 3 - heat shock 70kDa protein 14 |