MTP18-mitochondrial protein 18 kDa Gene View larger

MTP18-mitochondrial protein 18 kDa Gene

PTXBC046132

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTP18-mitochondrial protein 18 kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTP18-mitochondrial protein 18 kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC046132
Product type: DNA & cDNA
Ncbi symbol: MTP18
Origin species: Human
Product name: MTP18-mitochondrial protein 18 kDa Gene
Size: 2ug
Accessions: BC046132
Gene id: 51537
Gene description: mitochondrial protein 18 kDa
Synonyms: mitochondrial fission protein MTP18; MTP18; HSPC242; mitochondrial fission process protein 1; mitochondrial 18 kDa protein; mitochondrial protein 18 kDa; mitochondrial fission process 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagagccgcagccgcggggcgcagagcgcgatctctaccgggacacgtgggtgcgatacctgggctatgccaatgaggtgggcgaggctttccgctctcttgtgccagcggcggtggtgtggctgagctatggcgtggccagctcctacgtgctggcggatgccattgacaaaggcaagaaggctggagaggtgcccagccctgaagcaggccgcagcgccagggtgactgtggctgtggtggacacctttgtatggcaggctctagcctctgtggccattccgggcttcaccatcaaccgcgtgtgtgctgcctctctctatgtcctgggcactgccacccgctggcccctggctgtccgcaagtggaccaccaccgcgcttgggctgttgaccatccccatcattatccaccccattgacaggtcggtggatttcctcctggactccagcctgcgcaagctctacccaacagtggggaagcccagctcctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - YTH domain family, member 3
- heat shock 70kDa protein 14
- tropomyosin 3 pseudogene
- receptor accessory protein 5

Buy MTP18-mitochondrial protein 18 kDa Gene now

Add to cart