Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MRAS-muscle RAS oncogene homolog Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRAS-muscle RAS oncogene homolog Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047690 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRAS |
| Origin species: | Human |
| Product name: | MRAS-muscle RAS oncogene homolog Gene |
| Size: | 2ug |
| Accessions: | BC047690 |
| Gene id: | 22808 |
| Gene description: | muscle RAS oncogene homolog |
| Synonyms: | M-RAs; R-RAS3; RRAS3; ras-related protein M-Ras; muscle and microspikes RAS; ras-related protein R-Ras3; muscle RAS oncogene homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggagcaatacatgcgcacgggggatggcttcctcatcgtctactccgtcactgacaaggccagctttgagcacgtggaccgcttccaccagcttatcctgcgcgtcaaagacagggagtcattcccgatgatcctcgtggccaacaaggtcgatttgatgcacttgaggaagatcaccagggagcaaggaaaagaaatggcgaccaaacacaatattccgtacatagaaaccagtgccaaggacccacctctcaatgtcgacaaagccttccatgacctcgttagagtaattaggcaacagattccggaaaaaagccagaagaagaagaagaaaaccaaatggcggggagaccgggccacaggcacccacaaactgcaatgtgtgatcttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin repeat domain 36 - yippee-like 3 (Drosophila) - ring finger protein 144A - zinc finger protein 322A |