Login to display prices
Login to display prices
RNF144A-ring finger protein 144A Gene View larger

RNF144A-ring finger protein 144A Gene

PTXBC050373

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF144A-ring finger protein 144A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF144A-ring finger protein 144A Gene

Proteogenix catalog: PTXBC050373
Ncbi symbol: RNF144A
Product name: RNF144A-ring finger protein 144A Gene
Size: 2ug
Accessions: BC050373
Gene id: 9781
Gene description: ring finger protein 144A
Synonyms: E3 ubiquitin-protein ligase RNF144A; RNF144; UBCE7IP4; UbcM4-interacting protein 4; ring finger protein 144; ubiquitin conjugating enzyme 7 interacting protein 4; ring finger protein 144A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacagcaaggtaccggcccacctgggacctggccctcgacccgctggtgtcttgcaagctctgtcttggggagtacccagtggagcagatgacaaccatagcccagtgccaatgcatcttctgtactctgtgcctgaaacagtatgttgagctcttgatcaaagaaggattagaaaccgcaattagctgcccagatgctgcctgccctaaacagggccacctacaggagaacgagattgagtgcatggttgcagctgaaattatgcaaagatataaaaagctacaatttgaaagagaggtgctgtttgatccctgtcggacttggtgcccggcgtccacctgccaagctgtgtgtcagctccaggacgtggggctgcagaccccccagccagtgcagtgcaaagcctgccgtatggaattctgctccacctgcaaagccagctggcaccctggccagggctgcccggagaccatgccgatcaccttcctccccggggagaccagtgctgctttcaaaatggaagaagatgacgcgcccatcaagcgctgccccaagtgcaaagtctacatcgagcgagacgaaggctgcgcgcagatgatgtgcaagaactgcaagcacgccttctgctggtactgcctggagtctctggacgatgatttccttctgatacactacgataagggaccctgccggaacaagctgggccactcccgggcatctgtgatctggcatcggacacaggttgtgggcatttttgcaggatttgggctgctgctcttggtggcctcacctttcctactcctggccactccctttgtactttgctgcaagtgcaagtgcagtaaaggtgacgacgacccgttacccacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: