RNF144A-ring finger protein 144A Gene View larger

RNF144A-ring finger protein 144A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF144A-ring finger protein 144A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RNF144A-ring finger protein 144A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050373
Product type: DNA & cDNA
Ncbi symbol: RNF144A
Origin species: Human
Product name: RNF144A-ring finger protein 144A Gene
Size: 2ug
Accessions: BC050373
Gene id: 9781
Gene description: ring finger protein 144A
Synonyms: E3 ubiquitin-protein ligase RNF144A; RNF144; UBCE7IP4; UbcM4-interacting protein 4; ring finger protein 144; ubiquitin conjugating enzyme 7 interacting protein 4; ring finger protein 144A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacagcaaggtaccggcccacctgggacctggccctcgacccgctggtgtcttgcaagctctgtcttggggagtacccagtggagcagatgacaaccatagcccagtgccaatgcatcttctgtactctgtgcctgaaacagtatgttgagctcttgatcaaagaaggattagaaaccgcaattagctgcccagatgctgcctgccctaaacagggccacctacaggagaacgagattgagtgcatggttgcagctgaaattatgcaaagatataaaaagctacaatttgaaagagaggtgctgtttgatccctgtcggacttggtgcccggcgtccacctgccaagctgtgtgtcagctccaggacgtggggctgcagaccccccagccagtgcagtgcaaagcctgccgtatggaattctgctccacctgcaaagccagctggcaccctggccagggctgcccggagaccatgccgatcaccttcctccccggggagaccagtgctgctttcaaaatggaagaagatgacgcgcccatcaagcgctgccccaagtgcaaagtctacatcgagcgagacgaaggctgcgcgcagatgatgtgcaagaactgcaagcacgccttctgctggtactgcctggagtctctggacgatgatttccttctgatacactacgataagggaccctgccggaacaagctgggccactcccgggcatctgtgatctggcatcggacacaggttgtgggcatttttgcaggatttgggctgctgctcttggtggcctcacctttcctactcctggccactccctttgtactttgctgcaagtgcaagtgcagtaaaggtgacgacgacccgttacccacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 322A
- kinesin family member 16B
- matrix metallopeptidase 19
- RNA binding motif protein 6

Buy RNF144A-ring finger protein 144A Gene now

Add to cart