Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MGC87042-similar to Six transmembrane epithelial antigen of prostate Gene
PTXBC066301
New product
Data sheet of MGC87042-similar to Six transmembrane epithelial antigen of prostate Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC87042-similar to Six transmembrane epithelial antigen of prostate Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066301 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC87042 |
| Origin species: | Human |
| Product name: | MGC87042-similar to Six transmembrane epithelial antigen of prostate Gene |
| Size: | 2ug |
| Accessions: | BC066301 |
| Gene id: | 256227 |
| Gene description: | similar to Six transmembrane epithelial antigen of prostate |
| Synonyms: | STEAP family protein MGC87042; STEAP family member 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaagcagaaaagacatcacaaaccaagaagaaatttggaaaatgaagcctaggagaaatttagaagacaacgattatttgcaaacggcccatgctgatgaatttgactgcccttcagaacttcagcacgcacaggaactctttccacagtggcacttgccaattaaaatagctgctgttatggcatctctgacttttctttacactcttctgagggaagtaattcaccctttagcaacttcccatcaacaatatttttataaaattccaatcctggtcatcaacaaagtcttgccaatggtttccatcactctcttggcattggtttacctaccaggtgtgatagcagcaattgtccaggttcataatggaaccaagtataagaagtttccacattggttggataagtggatgttaacaagaaagcagtttgggcttctcagtttgttttttgctgtactgcatgcaatttatactctgtcttacgcaatgaggcgatcctacagatacaagttgctaaactgggcatatcaacaggtccaacaaaataaagaagatgcctggattgagcatgatgtttggagaatggagatttatgtgtctctgggaattgtgggactggcaatactggctctgttggctgtgacatctattccatctgtgagtgactctttgacatggagagaatttcactatattcaggtacatggtaggatcaacttcctgaccttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium inwardly-rectifying channel, subfamily J, member 12 - egf-like module containing, mucin-like, hormone receptor-like 1 - mitogen-activated protein kinase-activated protein kinase 5 - deoxynucleotidyltransferase, terminal, interacting protein 1 |