Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C10orf93-chromosome 10 open reading frame 93 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C10orf93-chromosome 10 open reading frame 93 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC044661 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C10orf93 |
| Origin species: | Human |
| Product name: | C10orf93-chromosome 10 open reading frame 93 Gene |
| Size: | 2ug |
| Accessions: | BC044661 |
| Gene id: | 255352 |
| Gene description: | chromosome 10 open reading frame 93 |
| Synonyms: | TPR repeat-containing protein C10orf93; C10orf93; C10orf123; C10orf124; C10orf92; TTC40; bA288G11.4; bA288G11.5; bB137A17.2; bB137A17.3; cilia- and flagella-associated protein 46; protein CFAP46; tetratricopeptide repeat domain 40; tetratricopeptide repeat protein 40; cilia and flagella associated protein 46 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacctggtcatcacgcaggagctggcccgcgccgagagccagcaagatgctgcgtccttgaagaaggcctacgagttgatcaaatcggccaacctagggaaatcggagtttgacccctcagagagcttcagcccagacctgtttgttctgtgtgcagagcaggccctgaagatgaggcagccagaggtgagcgaggactgcatccaaatgtacttcaaggtgaaggcgcccatcacccagtttctgggccgagcgcacctgtgcagggcccagatgtgtgccccgaagtcggcagaaaacctggaggaatttgaaaattgcgtgactgagtacatgaaggccataaactttgccaaaggagaaccgaggtactactttttggtgtacaatgcatcagtcctctactggcagatggtgaggccgttcctcaagcctggatatcgtcaccatctgatccccagcctttcccaaatcataaacgtgctgagtcagactgaggaggaagacaaggagtggcgtgctgagctgatgctggaacttctggagtgttatctgcaagccggaagaaaggaggaggctgccaggttctgctccacggcagctccgttcattaagtctcacgtgccacagaaataccggcagatattctctgttatggtaaatcagcgtattagaaatagagacgtaagaagtaattttcttaaaagtcattgttcagaaaactgcgtagaaattacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 10 open reading frame 96 - zinc finger, DHHC-type containing 24 - phosphatidic acid phosphatase type 2A - chromosome 9 open reading frame 150 |