Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPAP2A-phosphatidic acid phosphatase type 2A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPAP2A-phosphatidic acid phosphatase type 2A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039847 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPAP2A |
| Origin species: | Human |
| Product name: | PPAP2A-phosphatidic acid phosphatase type 2A Gene |
| Size: | 2ug |
| Accessions: | BC039847 |
| Gene id: | 8611 |
| Gene description: | phosphatidic acid phosphatase type 2A |
| Synonyms: | PPAP2A; LLP1a; LPP1; PAP-2a; PAP2; phospholipid phosphatase 1; lipid phosphate phosphohydrolase 1a; phosphatidate phosphohydrolase type 2a; phosphatidic acid phosphatase 2a; phosphatidic acid phosphatase type 2A; phosphatidic acid phosphohydrolase type 2a; type-2 phosphatidic acid phosphatase alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttgacaagacgcggctgccgtacgtggccctcgatgtgctctgcgtgttgctggctggattgccttttgcaattcttacttcaaggcatacccccttccaacgaggagtattctgtaatgatgagtccatcaagtacccttacaaagaagacaccataccttatgcgttattaggtggaataatcattccattcagtattatcgttattattcttggagaaaccctgtctgtttactgtaaccttttgcactcaaattcctttatcaggaataactacatagccactatttacaaagccattggaacctttttatttggtgcagctgctagtcagtccctgactgacattgccaagtattcaataggcagactgcggcctcacttcttggatgtttgtgatccagattggtcaaaaatcaactgcagcgatggttacattgaatactacatatgtcgagggaatgcagaaagagttaaggaaggcaggttgtccttctattcaggccactcttcgttttccatgtactgcatgctgtttgtggcactttatcttcaagccaggatgaagggagactgggcaagactcttacgccccacactgcaatttggtcttgttgccgtatccatttatgtgggcctttctcgagtttctgattataaacaccactggagcgatgtgttgactggactcattcagggagctctggttgcaatattagttgctgtatatgtatcggatttcttcaaagaaagaacttcttttaaagaaagaaaagaggaggactctcatacaactctgcatgaaacaccaacaactgggaatcactatccgagcaatcaccagccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 150 - chromosome 13 open reading frame 33 - cell division cycle associated 7-like - protein inhibitor of activated STAT, 4 |