PRRG1-proline rich Gla (G-carboxyglutamic acid) 1 Gene View larger

PRRG1-proline rich Gla (G-carboxyglutamic acid) 1 Gene

PTXBC060833

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRRG1-proline rich Gla (G-carboxyglutamic acid) 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRRG1-proline rich Gla (G-carboxyglutamic acid) 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC060833
Product type: DNA & cDNA
Ncbi symbol: PRRG1
Origin species: Human
Product name: PRRG1-proline rich Gla (G-carboxyglutamic acid) 1 Gene
Size: 2ug
Accessions: BC060833
Gene id: 5638
Gene description: proline rich Gla (G-carboxyglutamic acid) 1
Synonyms: PRGP1; transmembrane gamma-carboxyglutamic acid protein 1; proline rich Gla (G-carboxyglutamic acid) 1; proline-rich Gla (G-carboxyglutamic acid) polypeptide 1; proline rich and Gla domain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggagggttttcctcacgggagaaaaagccaattccatattaaaacgctacccaagagctaatgggttttttgaagaaataagacagggcaacattgagcgtgagtgcaaagaagaattctgtacatttgaagaagcaagagaagcttttgaaaataatgaaaaaactaaggagttttggagcacctacacaaaagcgcaacaaggggagagtaaccgaggaagtgactggtttcagttttaccttacctttccgttaatctttggcctcttcattatcctccttgtcattttcctaatctggagatgcttcctaagaaacaaaactcgtagacagacagtgactgaaggccacattcctttccctcagcaccttaatattatcaccccaccccccccaccagatgaagtgtttgacagcagtggattgtctccaggctttctgggatatgtagttgggcgctcagattccgtctctactcgcctgtccaattgtgatcccccgccaacctatgaggaagccactggccaagtgaacctgcagaggagtgaaacagaacctcatttagacccacccccagagtatgaggacatagtcaactccaactcagccagtgccattcctatggtgcctgtggtcaccaccatcaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Morf4 family associated protein 1-like 1
- family with sequence similarity 3, member B
- hyaluronan and proteoglycan link protein 1
- family with sequence similarity 3, member C

Buy PRRG1-proline rich Gla (G-carboxyglutamic acid) 1 Gene now

Add to cart