Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM3C-family with sequence similarity 3, member C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM3C-family with sequence similarity 3, member C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046932 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM3C |
| Origin species: | Human |
| Product name: | FAM3C-family with sequence similarity 3, member C Gene |
| Size: | 2ug |
| Accessions: | BC046932 |
| Gene id: | 10447 |
| Gene description: | family with sequence similarity 3, member C |
| Synonyms: | protein FAM3C; GS3786; ILEI; interleukin-like EMT inducer; interleukin-like epithelial-mesenchymal transition inducer; family with sequence similarity 3 member C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggtagcaggtgctgcaaagttggtggtagctgtggcagtgtttttactgacattttatgttatttctcaagtatttgaaataaaaatggatgcaagtttaggaaatctatttgcaagatcagcattggacacagctgcacgttctacaaagcctcccagatataagtgtgggatctcaaaagcttgccctgagaagcattttgcttttaaaatggcaagtggagcagccaacgtggtgggacccaaaatctgcctggaagataatgttttaatgagtggtgttaagaataatgttggaagagggatcaatgttgccttggcaaatggaaaaacaggagaagtattagacactaaatattttgacatgtggggaggagatgtggcaccatttattgagtttctgaaggccatacaagatggaacaatagttttaatgggaacatacgatgatggagcaaccaaactcaatgatgaggcacggcggctcattgctgatttggggagcacatctattactaatcttggttttagagacaactgggtcttctgtggtgggaagggcattaagacaaaaagcccttttgaacagcacataaagaacaataaggatacaaacaaatatgaaggatggcctgaagttgtagaaatggaaggatgcatcccccagaagcaagactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acyl-Coenzyme A binding domain containing 4 - dpy-19-like 2 pseudogene 1 (C. elegans) - zinc finger and SCAN domain containing 12 - phosphatidylethanolamine N-methyltransferase |