Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SFRS2-splicing factor, arginine/serine-rich 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SFRS2-splicing factor, arginine/serine-rich 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066958 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SFRS2 |
| Origin species: | Human |
| Product name: | SFRS2-splicing factor, arginine/serine-rich 2 Gene |
| Size: | 2ug |
| Accessions: | BC066958 |
| Gene id: | 6427 |
| Gene description: | splicing factor, arginine/serine-rich 2 |
| Synonyms: | SFRS2; PR264; SC-35; SFRS2A; SRp30b; serine/arginine-rich splicing factor 2; SR splicing factor 2; splicing component, 35 kDa; splicing factor SC35; splicing factor, arginine/serine-rich 2; serine and arginine rich splicing factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctacggccgcccccctcccgatgtggagggtatgacctccctcaaggtggacaacctgacctaccgcacctcgcccgacacgctgaggcgcgtcttcgagaagtacgggcgcgtcggcgacgtgtacatcccgcgggatcgctacaccaaggagtcccgcggcttcgccttcgttcgctttcacgacaagcgcgacgctgaggacgctatggatgccatggacggagccgatcccggagtcggagccgttccaggtctcgcagccgatctcgctacagccgctcgaagtctcggtcccgcactcgttctcgatctcggtcgacctccaagtccagatccgcacgaaggtccaagtccaagtcctcgtcggtctccagatctcgttcgcggtccaggtcccggtctcggtccaggagtcctcccccagtgtccaagagggaatccaaatccaggtcgcgatcgaagagtccccccaagtctcctgaagaggaaggagcggtgtcctcttaagaaaatgctgcggtctcctgtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DEAH (Asp-Glu-Ala-His) box polypeptide 8 - nurim (nuclear envelope membrane protein) - NOP16 nucleolar protein homolog (yeast) - glutamate receptor, ionotropic, delta 1 |