SFRS2-splicing factor, arginine/serine-rich 2 Gene View larger

SFRS2-splicing factor, arginine/serine-rich 2 Gene

PTXBC066958

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFRS2-splicing factor, arginine/serine-rich 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SFRS2-splicing factor, arginine/serine-rich 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066958
Product type: DNA & cDNA
Ncbi symbol: SFRS2
Origin species: Human
Product name: SFRS2-splicing factor, arginine/serine-rich 2 Gene
Size: 2ug
Accessions: BC066958
Gene id: 6427
Gene description: splicing factor, arginine/serine-rich 2
Synonyms: SFRS2; PR264; SC-35; SFRS2A; SRp30b; serine/arginine-rich splicing factor 2; SR splicing factor 2; splicing component, 35 kDa; splicing factor SC35; splicing factor, arginine/serine-rich 2; serine and arginine rich splicing factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctacggccgcccccctcccgatgtggagggtatgacctccctcaaggtggacaacctgacctaccgcacctcgcccgacacgctgaggcgcgtcttcgagaagtacgggcgcgtcggcgacgtgtacatcccgcgggatcgctacaccaaggagtcccgcggcttcgccttcgttcgctttcacgacaagcgcgacgctgaggacgctatggatgccatggacggagccgatcccggagtcggagccgttccaggtctcgcagccgatctcgctacagccgctcgaagtctcggtcccgcactcgttctcgatctcggtcgacctccaagtccagatccgcacgaaggtccaagtccaagtcctcgtcggtctccagatctcgttcgcggtccaggtcccggtctcggtccaggagtcctcccccagtgtccaagagggaatccaaatccaggtcgcgatcgaagagtccccccaagtctcctgaagaggaaggagcggtgtcctcttaagaaaatgctgcggtctcctgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DEAH (Asp-Glu-Ala-His) box polypeptide 8
- nurim (nuclear envelope membrane protein)
- NOP16 nucleolar protein homolog (yeast)
- glutamate receptor, ionotropic, delta 1

Buy SFRS2-splicing factor, arginine/serine-rich 2 Gene now

Add to cart