SEPW1-selenoprotein W, 1 Gene View larger

SEPW1-selenoprotein W, 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEPW1-selenoprotein W, 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SEPW1-selenoprotein W, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000581
Product type: DNA & cDNA
Ncbi symbol: SEPW1
Origin species: Human
Product name: SEPW1-selenoprotein W, 1 Gene
Size: 2ug
Accessions: BC000581
Gene id: 6415
Gene description: selenoprotein W, 1
Synonyms: SEPW1; selW; selenoprotein W; selenoprotein W, 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctcgccgtccgagtcgtttattgtggcgcttgaggctacaagtccaagtatcttcagctcaagaagaagttagaagatgagttccccggccgcctggacatctgcggcgagggaactccccaggccaccgggttctttgaagtgatggtagccgggaagttgattcactctaagaagaaaggcgatggctacgtggacacagaaagcaagtttctgaagttggtggccgccatcaaagccgccttggctcagggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nephronophthisis 4
- tubulin, alpha 3d
- tubulin, alpha 3e
- PARK2 co-regulated

Buy SEPW1-selenoprotein W, 1 Gene now

Add to cart